Introduction
CIViC provides a simple API that can be utilized over HTTP in the programming language of your choice or even at the command line.
The CIViC API attempts to be RESTful whenever appropriate which hopefully makes it intuitive to use. There are four main entities in the system that a user may interact with: Genes, Variants, Variant Groups, and Evidence Items. These entities form a hierarchy that is reflected in the API endpoints. A Gene has one or more Variants, each of which may have one or more Evidence Items. Variants may also be collected into Variant Groups.
This documentation provides example requests and responses for most endpoints. The responses are edited for brevity, but should include instances of each top level key for reference. You can toggle between viewing a request and its corresponding response using the tabs on the right of the page.
Endpoint Types
The API for consuming CIViC data can mostly be broken down into two different types of endpoints: index and detail.
Index
Example of a meta section for the genes index endpoint
curl https://civicdb.org/api/genes
{
"_meta": {
"current_page": 2,
"per_page": "25",
"total_pages": 11,
"total_count": 266,
"links": {
"next": "https://civicdb.org/api/genes?count=25&page=3",
"previous": "https://civicdb.org/api/genes?count=25&page=1"
}
}
}
The index endpoints provide high level overview information about a collection of entities all at once and allow a user to page through all the entities in the system.
Index endpoints provide two top-level keys in their JSON structure: _meta and records.
Meta
As seen to the right, the _meta section contains information about the total number of available records, the page size, and provides links to the next and previous page of results.
These links can be used to easily traverse all of the records in CIViC. A null entry for next (or previous) indicates that you have reached the end of the collection.
Records
The records section will contain the actual objects requested in the API call (ie: genes, variants or evidence_items)
If you do not wish to use the links in the _meta section, index endpoints also accept manual pagination parameters in the query string:
| Parameter | Default | Description |
|---|---|---|
| page | 1 | Which page of results to return |
| count | 25 | How many records to return on a single page |
Detail
Example of a detail response for the genes endpoint
curl https://civicdb.org/api/genes/19
{
"id": 19,
"name": "EGFR",
"entrez_id": 1956,
"description": "EGFR is widely recognized for its importance in cancer. Amplification and mutations have been shown to be driving events in many cancer types. Its role in non-small cell lung cancer, glioblastoma and basal-like breast cancers has spurred many research and drug development efforts. Tyrosine kinase inhibitors have shown efficacy in EGFR amplfied tumors, most notably gefitinib and erlotinib. Mutations in EGFR have been shown to confer resistance to these drugs, particularly the variant T790M, which has been functionally characterized as a resistance marker for both of these drugs. The later generation TKI's have seen some success in treating these resistant cases, and targeted sequencing of the EGFR locus has become a common practice in treatment of non-small cell lung cancer. \nOverproduction of ligands is another possible mechanism of activation of EGFR. ERBB ligands include EGF, TGF-a, AREG, EPG, BTC, HB-EGF, EPR and NRG1-4 (for detailed information please refer to the respective ligand section). In ligand-activated cancers, Cetuximab appears to be more effective than tyrosine-kinase inhibitors (Arteaga et. al.).",
"variants": [
{
"name": "S492R",
"id": 453,
"evidence_items": {
"accepted_count": 4,
"rejected_count": 0,
"submitted_count": 0
}
},
{
"name": "3' UTR MUTATION",
"id": 253,
"evidence_items": {
"accepted_count": 0,
"rejected_count": 1,
"submitted_count": 0
}
},
{
"name": "K467T",
"id": 455,
"evidence_items": {
"accepted_count": 2,
"rejected_count": 0,
"submitted_count": 0
}
}
],
"aliases": [
"HER1",
"ERBB1",
"ERBB"
],
"type": "gene",
"variant_groups": [
{
"id": 12,
"name": "EGFR TKI Resistance",
"description": "EGFR pathway activation is a nearly ubiquitous hallmark of cancer. Many tyrosine kinase inhibitors have been developed to target EGFR pathway activity. One such inhibitor, erlotinib, has demonstrated efficacy in an EGFR over-active setting. However, the T790M missense mutation has shown to confer resistance to this inhibitor in cell lines and case studies. ",
"variants": [
{
"id": 34,
"entrez_name": "EGFR",
"gene_id": 19,
"entrez_id": 1956,
"name": "T790M",
"description": "EGFR T790M was one of the very first mutations recognized to confer resistance to targeted therapies in non-small cell lung cancer. While successful in amplified EGFR, the efficacy of the first and second generation TKI's (erlotinib, gefitinib, neratinib) in treating patients harboring this mutation before treatment is notably lower. This lack of efficacy can likely be to blame for the poorer prognosis for patients with this mutation as compared to patients with wildtype EGFR or other types of EGFR mutations. Approximately half of EGFR mutant tumors with acquired resistance to TKI inhibition have been shown to harbor this mutation, implicating it as a mechanism of acquired therapy resistence. A third generation TKI (osimertinib) has been approved for the treatment of EGFR T790M mutant NSCLC. Patients positive for T790M in a plasma-based test have similar outcomes like those with tumor biopsy testing.",
"type": "variant",
"variant_types": [
{
"id": 47,
"name": "missense_variant",
"display_name": "Missense Variant",
"so_id": "SO:0001583",
"description": "A sequence variant, that changes one or more bases, resulting in a different amino acid sequence but where the length is preserved.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001583"
}
],
"evidence_items": {
"accepted_count": 19,
"rejected_count": 0,
"submitted_count": 1
},
"coordinates": {
"chromosome": "7",
"start": "55249071",
"stop": "55249071",
"reference_bases": "C",
"variant_bases": "T",
"representative_transcript": "ENST00000275493.2",
"chromosome2": null,
"start2": null,
"stop2": null,
"representative_transcript2": null,
"ensembl_version": 75,
"reference_build": "GRCh37"
}
}
],
"type": "variant_group"
}
],
"lifecycle_actions": {
"last_modified": {
"order": 0,
"timestamp": "2016-01-07T09:04:18.614Z",
"user": {
"id": 100,
"email": "damian.rieke@charite.de",
"name": "Damian Rieke",
"last_seen_at": "2016-12-12T13:23:11.578Z",
"username": "DTRieke",
"role": "editor",
"avatar_url": "https://secure.gravatar.com/avatar/baaffa3938cc82f434ca5561e34d3de9.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/baaffa3938cc82f434ca5561e34d3de9.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/baaffa3938cc82f434ca5561e34d3de9.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/baaffa3938cc82f434ca5561e34d3de9.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/baaffa3938cc82f434ca5561e34d3de9.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Clinical Scientist",
"orcid": "0000-0003-0027-7977",
"display_name": "DTRieke",
"created_at": "2015-12-14T08:37:49.264Z",
"url": "",
"twitter_handle": null,
"facebook_profile": null,
"linkedin_profile": null,
"bio": null,
"featured_expert": false,
"accepted_license": null,
"signup_complete": null
}
},
},
"sources": [
{
"id": 26,
"name": "Epidermal growth factor receptor targeting in cancer: a review of trends and strategies.",
"citation": "Yewale et al., 2013, Biomaterials",
"pubmed_id": "23953842",
"source_url": "http://www.ncbi.nlm.nih.gov/pubmed/23953842",
"open_access": null,
"pmc_id": null,
"publication_date": {
"year": 2013,
"month": 11
},
"journal": "Biomaterials",
"full_journal_title": "Biomaterials",
"status": "fully curated"
},
],
"errors": {}
}
Detail endpoints return the full CIViC record for a single entity, specified explicitly by id.
In addition to the high level overview information returned by the index endpoint, this complete record will include information about data provenance, timestamps, and secondary relationships.
Unlike the index endpoints, detail endpoints do not have separate _meta and records sections as only a single record is returned.
Genes
For most users, the primary entry point for the CIViC API will be the Genes endpoint. This endpoint allows a user to retrieve information about what genes are in CIViC as well as get lists of variants for specific genes.
Get a list of genes
curl https://civicdb.org/api/genes
{
"_meta": {
"current_page": 1,
"per_page": 25,
"total_pages": 11,
"total_count": 267,
"links": {
"next": "https://civicdb.org/api/genes?count=25&page=2",
"previous": null
}
},
"records": [
{
"id": 1,
"name": "ALK",
"entrez_id": 238,
"description": "ALK amplifications, fusions and mutations have been shown to be driving events in non-small cell lung cancer. While crizontinib has demonstrated efficacy in treating the amplification, mutations in ALK have been shown to confer resistance to current tyrosine kinase inhibitors. Second-generation TKI's have seen varied success in treating these resistant cases, and the HSP90 inhibitor 17-AAG has been shown to be cytostatic in ALK-altered cell lines.",
"variants": [
{
"name": "DEL4-11",
"id": 550,
"evidence_items": {
"accepted_count": 1,
"rejected_count": 0,
"submitted_count": 0
}
},
{
"name": "CLTC-ALK",
"id": 520,
"evidence_items": {
"accepted_count": 3,
"rejected_count": 0,
"submitted_count": 0
}
},
{
"name": "EML4-ALK V1180L",
"id": 528,
"evidence_items": {
"accepted_count": 5,
"rejected_count": 0,
"submitted_count": 0
}
},
],
"aliases": [
"NBLST3",
"CD246"
],
"type": "gene"
},
{
"id": 2,
"name": "AKT1",
"entrez_id": 207,
"description": "AKT1, also referred to as protein kinase B, is a known oncogene. AKT activation relies on the PI3K pathway, and is recognized as a critical node in the pathway. The E17 hotspot is the most characterized of AKT1 mutations, and has been shown to result in activation of the protein. Mutations in AKT1 have also been shown to confer resistance to allosteric kinase inhibitors in vitro.",
"variants": [
{
"name": "Q79K",
"id": 169,
"evidence_items": {
"accepted_count": 1,
"rejected_count": 0,
"submitted_count": 0
}
}
],
"aliases": [
"RAC-ALPHA",
"PKB",
"AKT",
"PKB-ALPHA",
"RAC",
"CWS6",
"PRKBA"
],
"type": "gene"
},
]
}
This endpoint returns a listing of genes in CIViC that contain at least one evidence item. Returned gene listings contain variant ids which can be used to query for more detailed variant information.
This is an index style endpoint and is paginated by default. You can use the count and page parameters to iterate through all the variants.
HTTP Request
GET https://civicdb.org/api/genes
Query Parameters
| Parameter | Default | Description |
|---|---|---|
| page | 1 | Which page of results to return |
| count | 25 | How many genes to return on a single page |
Get details for a specific gene
curl https://civicdb.org/api/genes/ALK?identifier_type=entrez_symbol
{
"id": 1,
"name": "ALK",
"entrez_id": 238,
"description": "ALK amplifications, fusions and mutations have been shown to be driving events in non-small cell lung cancer. While crizontinib has demonstrated efficacy in treating the amplification, mutations in ALK have been shown to confer resistance to current tyrosine kinase inhibitors. Second-generation TKI's have seen varied success in treating these resistant cases, and the HSP90 inhibitor 17-AAG has been shown to be cytostatic in ALK-altered cell lines.",
"variants": [
{
"name": "EML4-ALK L1152R",
"id": 307,
"evidence_items": {
"accepted_count": 1,
"rejected_count": 0,
"submitted_count": 0
}
},
{
"name": "F1245C",
"id": 549,
"evidence_items": {
"accepted_count": 2,
"rejected_count": 0,
"submitted_count": 0
}
},
],
"aliases": [
"NBLST3",
"CD246"
],
"type": "gene",
"variant_groups": [
{
"id": 11,
"name": "ALK Fusions",
"description": "ALK fusion positive non-small cell lung cancer (NSCLC) is treated as its own subset of NSCLC. Many ALK fusions that have been seen as recurrent in cancer serve to increase the activity of the ALK oncogene relative to normal cells. While EML4 is the most common fusion partner, other 5' partners have been observed. The EML4-ALK fusion has shown sensitivity to targeted tyrosine kinase inhibitors such as crizotinib. ",
"variants": [
{
"id": 520,
"entrez_name": "ALK",
"gene_id": 1,
"entrez_id": 238,
"name": "CLTC-ALK",
"description": "The t(2;17)(p23;q23) translocation results in the CLTC-ALK fusion protein, the most common ALK fusion observed in diffuse large B cell lymphoma (DLBCL). ALK-rearranged DLBCL is less responsive to CHOP chemotherapy. Preclinical work indicates that CLTC-ALK DLBCL is responsive to ALK inhibition in cell lines and mouse models, and two case studies show short response followed by progression when heavily pretreated and advanced ALK-positive DLBCL is treated with crizotinib (one case CLTC-ALK, one case an unknown ALK fusion).",
"type": "variant",
"variant_types": [
{
"id": 120,
"name": "transcript_fusion",
"display_name": "Transcript Fusion",
"so_id": "SO:0001886",
"description": "A feature fusion where the deletion brings together transcript regions.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001886"
}
],
"evidence_items": {
"accepted_count": 3,
"rejected_count": 0,
"submitted_count": 0
},
"coordinates": {
"chromosome": "17",
"start": "57697219",
"stop": "57768072",
"reference_bases": null,
"variant_bases": null,
"representative_transcript": "ENST00000269122.3",
"chromosome2": "2",
"start2": "29415640",
"stop2": "29446394",
"representative_transcript2": "ENST00000389048.3",
"ensembl_version": 75,
"reference_build": "GRCh37"
}
},
{
"id": 514,
"entrez_name": "ALK",
"gene_id": 1,
"entrez_id": 238,
"name": "RANBP2-ALK",
"description": "",
"type": "variant",
"variant_types": [
{
"id": 120,
"name": "transcript_fusion",
"display_name": "Transcript Fusion",
"so_id": "SO:0001886",
"description": "A feature fusion where the deletion brings together transcript regions.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001886"
}
],
"evidence_items": {
"accepted_count": 1,
"rejected_count": 0,
"submitted_count": 0
},
"coordinates": {
"chromosome": "2",
"start": "109335937",
"stop": "109375004",
"reference_bases": null,
"variant_bases": null,
"representative_transcript": "ENST00000283195.6",
"chromosome2": "2",
"start2": "29415640",
"stop2": "29446394",
"representative_transcript2": "ENST00000389048.3",
"ensembl_version": 75,
"reference_build": "GRCh37"
}
},
],
"type": "variant_group"
}
],
"lifecycle_actions": {},
"sources": [
{
"id": 2,
"name": "ALK in lung cancer: past, present, and future.",
"citation": "Shaw et al., 2013, J. Clin. Oncol.",
"pubmed_id": "23401436",
"source_url": "http://www.ncbi.nlm.nih.gov/pubmed/23401436",
"open_access": true,
"pmc_id": "PMC4209068",
"publication_date": {
"year": 2013,
"month": 3,
"day": 10
},
"journal": "J. Clin. Oncol.",
"full_journal_title": "Journal of clinical oncology : official journal of the American Society of Clinical Oncology",
"status": "fully curated"
}
],
"errors": {}
}
This endpoint retrieves details about a specific gene.
Note that the default behavior of this endpoint is to use internal CIViC ids. If you want to use Entrez ids or gene symbols, you need to specify the identifier_type parameter.
HTTP Request
GET https://civicdb.org/api/genes/:id
URL Parameters
| Parameter | Valid Values | Description |
|---|---|---|
| identifier_type | entrez_id, entrez_symbol, civic_id |
Type of gene identifier used in your query. |
Get several genes at once via an indentifier
curl https://civicdb.org/api/genes/TP53,BRAF?identifier_type=entrez_symbol
[
{
"id": 5,
"name": "BRAF",
"entrez_id": 673,
"description": "BRAF mutations are found to be recurrent in many cancer types. Of these, the mutation of valine 600 to glutamic acid (V600E) is the most prevalent. V600E has been determined to be an activating mutation, and cells that harbor it, along with other V600 mutations are sensitive to the BRAF inhibitor dabrafenib. It is also common to use MEK inhibition as a substitute for BRAF inhibitors, and the MEK inhibitor trametinib has seen some success in BRAF mutant melanomas. BRAF mutations have also been correlated with poor prognosis in many cancer types, although there is at least one study that questions this conclusion in papillary thyroid cancer.",
"variants": [
{
"name": "D594G",
"id": 611,
"evidence_items": {
"accepted_count": 3,
"rejected_count": 0,
"submitted_count": 0
}
},
{
"name": "L597V",
"id": 585,
"evidence_items": {
"accepted_count": 1,
"rejected_count": 0,
"submitted_count": 0
}
},
],
"aliases": [
"RAFB1",
"NS7",
"BRAF1",
"B-RAF1"
],
"type": "gene"
},
{
"id": 45,
"name": "TP53",
"entrez_id": 7157,
"description": "TP53 mutations are universal across cancer types. Loss of tumor suppressors is most recognized by large deleterious events, such as frameshift mutations, or premature stop codons. In TP53 however, many of the observed mutations in cancer are found to be single nucleotide variants, or missense mutations. These variants are also very broadly distributed throughout the gene, not localizing in any particular hotspot. While a large proportion of cancer genomics research is focused on somatic variants, TP53 is also of note in the germline. Germline TP53 mutations are the hallmark of Li-Fraumeni syndrome, and many (both germline and somatic) have been found to have prognostic impact on patient outcomes. The significance of many polymorphisms in susceptibility and prognosis of disease is still very much up for debate.",
"variants": [
{
"name": "P72R",
"id": 531,
"evidence_items": {
"accepted_count": 3,
"rejected_count": 0,
"submitted_count": 0
}
},
],
"aliases": [
"TRP53",
"P53",
"LFS1",
"BCC7"
],
"type": "gene"
}
]
The endpoint can be used to fetch overview information for multiple genes at the same time. It supports the same identifier_types as the detail endpoint.
HTTP Request
GET https://civicdb.org/api/genes/TP53,BRAF?identifier_type=entrez_symbol
Query Parameters
| Parameter | Valid Values | Description |
|---|---|---|
| identifier_type | entrez_id, entrez_symbol, civic_id |
Type of gene identifier used in your query. |
Variants
The variants endpoint allows users to enumerate all of the variants present in CIViC as well as retrieve more detailed information on a specific variant. A common use case would be to get a list of variants for a gene using the genes endpoint and then fetching detailed information for each variant via the variants endpoint.
Get a list of variants
curl https://civicdb.org/api/variants
{
"_meta": {
"current_page": 1,
"per_page": 25,
"total_pages": 30,
"total_count": 729,
"links": {
"next": "https://civicdb.org/api/variants?count=25&page=2",
"previous": null
}
},
"records": [
{
"id": 1,
"entrez_name": "ABL1",
"gene_id": 4,
"entrez_id": 25,
"name": "BCR-ABL",
"description": "The BCR-ABL fusion protein, commonly referred to as the Philadelphia chromosome, is one of the most studied fusion genes in cancer. It has widely been considered the initiating event in chronic myelogenous leukemia (CML). However, despite its ability to initiate disease in mice, its status as an initiating mutation is in dispute. In what is commonly used as the poster-child for targeted therapeutics, the development and use of imatinib in the clinic has led to profound improvements in the prognosis of the disease. However, imatinib resistance is still seen in patients with mutations in the ABL kinase domain of the fusion, most notably the T315I variant. In patients resistant to imatinib, either acquired or otherwise, second generation BCR-ABL TKI's (dasatinib and ponatinib) have seen some success in delivering a tumor response.",
"type": "variant",
"variant_types": [
],
"evidence_items": {
"accepted_count": 7,
"rejected_count": 0,
"submitted_count": 0
},
"coordinates": {
"chromosome": "22",
"start": "23522397",
"stop": "23632600",
"reference_bases": null,
"variant_bases": null,
"representative_transcript": "ENST00000305877.8",
"chromosome2": "9",
"start2": "133729451",
"stop2": "133763063",
"representative_transcript2": "ENST00000318560.5",
"ensembl_version": 75,
"reference_build": "GRCh37"
}
},
{
"id": 28,
"entrez_name": "CEBPA",
"gene_id": 15,
"entrez_id": 1050,
"name": "N-TERMINAL FRAME SHIFT",
"description": "CEBPA N-terminal frame shift mutations that result in a premature stop codon are associated with cytogenetically normal acute myeloid leukemia (CN-AML). CEBPA mutations are associated with a favorable prognosis; however, NPM1 and FLT3 mutations should also be assessed in CN-AML patients as concurrent mutations may have prognostic implications. N-terminal frame shift mutations within amino acids 1-120 have been shown to disrupt expression of the full-length 42kDa isoform while maintaining expression of a 30kDa isoform (translated from the AUG at full-length protein isoform amino acid M120). This 30kDa isoform exhibits dominant negative activity.",
"type": "variant",
"variant_types": [
{
"id": 134,
"name": "frameshift_truncation",
"display_name": "Frameshift Truncation",
"so_id": "SO:0001910",
"description": "A frameshift variant that causes the translational reading frame to be shortened relative to the reference feature.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001910"
},
],
"evidence_items": {
"accepted_count": 2,
"rejected_count": 0,
"submitted_count": 0
},
"coordinates": {
"chromosome": "19",
"start": "33792961",
"stop": "33793470",
"reference_bases": null,
"variant_bases": null,
"representative_transcript": "ENST00000498907.2",
"chromosome2": null,
"start2": null,
"stop2": null,
"representative_transcript2": null,
"ensembl_version": 75,
"reference_build": "GRCh37"
}
}
]
}
This endpoint returns a listing of variants in CIViC that contain at least one evidence item. This index style endpoint is paginated by default. You can use the count and page parameters or the previous and next links to iterate through all the variants.
HTTP Request
GET https://civicdb.org/api/variants
Query Parameters
| Parameter | Default | Description |
|---|---|---|
| page | 1 | Which page of results to return |
| count | 25 | How many variants to return on a single page |
Get details for a specific variant.
curl https://civicdb.org/api/variants/8
{
"id": 8,
"entrez_name": "ALK",
"gene_id": 1,
"entrez_id": 238,
"name": "F1174L",
"description": "ALK F1174L has been observed as recurrent in neuroblastoma, non-small cell lung cancer (NSCLC), and other cancer types. Neuroblastoma cells containing this mutation have shown resistance to low doses of criztonib. However, increased dosage can overcome this resistance in cell lines studies. TAE684 has also proven effective in both NSCLC and neuroblastoma F1174L containing cells.",
"type": "variant",
"variant_types": [
{
"id": 47,
"name": "missense_variant",
"display_name": "Missense Variant",
"so_id": "SO:0001583",
"description": "A sequence variant, that changes one or more bases, resulting in a different amino acid sequence but where the length is preserved.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001583"
}
],
"evidence_items": [
{
"id": 1271,
"name": "EID1271",
"description": "In a Phase I trial (NCT00939770) of the drug crizotinib in pediatric patients, a subset of 11 neuroblastoma patients were characterized for mutations in ALK. Of these 11 patients, 4 had the F1174L mutation. Among these 4 patients, stable disease (SD) was observed in one, and progressive disease (PD) was observed in 3 others after administration of crizotinib. In contrast, in the remaining 7 patients with mutations different than F1174L, 4 had PD, 2 had SD and one had complete response as best response after initiation of crizotinib.",
"disease": {
"id": 13,
"name": "Neuroblastoma",
"display_name": "Neuroblastoma",
"doid": "769",
"url": "http://www.disease-ontology.org/?id=DOID:769"
},
"drugs": [
{
"id": 12,
"name": "Crizotinib",
"pubchem_id": null
}
],
"rating": 3,
"evidence_level": "B",
"evidence_type": "Predictive",
"clinical_significance": "Sensitivity",
"evidence_direction": "Does Not Support",
"variant_origin": "Somatic Mutation",
"drug_interaction_type": null,
"status": "accepted",
"open_change_count": 0,
"type": "evidence",
"source": {
"id": 859,
"name": "Safety and activity of crizotinib for paediatric patients with refractory solid tumours or anaplastic large-cell lymphoma: a Children's Oncology Group phase 1 consortium study.",
"citation": "Mossé et al., 2013, Lancet Oncol.",
"pubmed_id": "23598171",
"source_url": "http://www.ncbi.nlm.nih.gov/pubmed/23598171",
"open_access": true,
"pmc_id": "PMC3730818",
"publication_date": {
"year": 2013,
"month": 5
},
"journal": "Lancet Oncol.",
"full_journal_title": "The Lancet. Oncology",
"status": "fully curated"
},
"variant_id": 8
},
],
"coordinates": {
"chromosome": "2",
"start": "29443695",
"stop": "29443695",
"reference_bases": "G",
"variant_bases": "T",
"representative_transcript": "ENST00000389048.3",
"chromosome2": null,
"start2": null,
"stop2": null,
"representative_transcript2": null,
"ensembl_version": 75,
"reference_build": "GRCh37"
},
"variant_groups": [
{
"id": 3,
"name": "Crizotinib Resistance",
"description": "The ALK oncogene has long been considered a driving factor in non-small cell lung cancer (NSCLC). The targeted tyrosine kinase inhibitor criztonib has shown to be effective in ALK-mutant NSCLC. However, in patients that have shown acquired resistance to crizotinib, missense mutations in the tyrosine kinase domain have shown to drive this resistance. ",
"variants": [
{
"id": 6,
"entrez_name": "ALK",
"gene_id": 1,
"entrez_id": 238,
"name": "EML4-ALK C1156Y",
"description": "In patients with non-small cell lung cancer exhibiting EML4-ALK fusion, C1156Y has been shown to confer resistance to crizotinib. Case reports indicate that secondary mutations can modulate drug sensitivity. EML4-ALK C1156Y/L1196M maintained crizotinib resistance while the lorlatinib resistant combination EML4-ALK C1156Y/L1198F re-sensitized the tumor to crizotinib treatment.",
"type": "variant",
"variant_types": [
{
"id": 120,
"name": "transcript_fusion",
"display_name": "Transcript Fusion",
"so_id": "SO:0001886",
"description": "A feature fusion where the deletion brings together transcript regions.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001886"
}
],
"evidence_items": {
"accepted_count": 3,
"rejected_count": 0,
"submitted_count": 0
},
"coordinates": {
"chromosome": "2",
"start": "29445258",
"stop": "29445258",
"reference_bases": "C",
"variant_bases": "T",
"representative_transcript": "ENST00000389048.3",
"chromosome2": null,
"start2": null,
"stop2": null,
"representative_transcript2": null,
"ensembl_version": 75,
"reference_build": "GRCh37"
}
},
],
"type": "variant_group"
}
],
"variant_aliases": [],
"hgvs_expressions": [],
"clinvar_entries": [],
"lifecycle_actions": {
"last_reviewed": {
"order": 1,
"timestamp": "2016-05-03T15:11:18.404Z",
"user": {
"id": 6,
"email": "kkrysiak@genome.wustl.edu",
"name": "Kilannin Krysiak",
"last_seen_at": "2017-01-04T16:05:02.406Z",
"username": "kkrysiak",
"role": "admin",
"avatar_url": "https://secure.gravatar.com/avatar/17180f9afc9f7f04fff97197c1ee5cb6.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/17180f9afc9f7f04fff97197c1ee5cb6.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/17180f9afc9f7f04fff97197c1ee5cb6.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/17180f9afc9f7f04fff97197c1ee5cb6.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/17180f9afc9f7f04fff97197c1ee5cb6.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Research Scientist",
"orcid": "0000-0002-6299-9230",
"display_name": "kkrysiak",
"created_at": "2015-02-26T04:14:20.953Z",
"url": "",
"twitter_handle": "",
"facebook_profile": "",
"linkedin_profile": "kilannin-krysiak-69047819",
"bio": "Dr. Krysiak is a staff scientist at the McDonnell Genome Institute at Washington University School of Medicine where she is involved in the comprehensive genomic analysis of cancer patient cohorts and “n-of-1” studies. She received her PhD in Molecular Genetics and Genomics at Washington University in St. Louis where she focused on the genetics of myelodysplastic syndrome through advanced flow cytometry techniques, primary cell culture and mouse models. She is a founding member of the CIViC team, helping to define the CIViC data model, and a leading content curator and feature development consultant.",
"featured_expert": true,
"accepted_license": null,
"signup_complete": null
}
}
},
"sources": [],
"errors": {}
}
This endpoint retrieves details about a specific variant, given its internal CIViC id.
HTTP Request
GET https://civicdb.org/api/variants/:id
Evidence Items
The evidence items endpoint allows users to enumerate all of the evidence items present in CIViC as well as retrieve more detailed information on a specific evidence item. This is the endpoint that should be used to obtain a complete listing of every evidence item in CIViC.
Get a list of evidence items
curl https://civicdb.org/api/evidence_items
{
"_meta": {
"current_page": 1,
"per_page": 25,
"total_pages": 69,
"total_count": 1722,
"links": {
"next": "https://civicdb.org/api/evidence_items?count=25&page=2",
"previous": null
}
},
"records": [
{
"id": 1,
"name": "EID1",
"description": "JAK2 V617F is not associated with lymphoid leukemia (B-lineage ALL, T-ALL or CLL).",
"disease": {
"id": 1,
"name": "Lymphoid Leukemia",
"display_name": "Lymphoid Leukemia",
"doid": "10747",
"url": "http://www.disease-ontology.org/?id=DOID:10747"
},
"drugs": [],
"rating": 4,
"evidence_level": "B",
"evidence_type": "Diagnostic",
"clinical_significance": "Negative",
"evidence_direction": "Supports",
"variant_origin": "Somatic Mutation",
"drug_interaction_type": null,
"status": "accepted",
"open_change_count": 0,
"type": "evidence",
"source": {
"id": 51,
"name": "The JAK2V617F activating mutation occurs in chronic myelomonocytic leukemia and acute myeloid leukemia, but not in acute lymphoblastic leukemia or chronic lymphocytic leukemia.",
"citation": "Levine et al., 2005, Blood",
"pubmed_id": "16081687",
"source_url": "http://www.ncbi.nlm.nih.gov/pubmed/16081687",
"open_access": true,
"pmc_id": "PMC1895066",
"publication_date": {
"year": 2005,
"month": 11,
"day": 15
},
"journal": "Blood",
"full_journal_title": "Blood",
"status": "fully curated"
},
"variant_id": 64
},
{
"id": 2,
"name": "EID2",
"description": "GIST tumors harboring PDGFRA D842V mutation are more likely to be benign than malignant.",
"disease": {
"id": 2,
"name": "Gastrointestinal Stromal Tumor",
"display_name": "Gastrointestinal Stromal Tumor",
"doid": "9253",
"url": "http://www.disease-ontology.org/?id=DOID:9253"
},
"drugs": [],
"rating": 3,
"evidence_level": "B",
"evidence_type": "Diagnostic",
"clinical_significance": "Negative",
"evidence_direction": "Supports",
"variant_origin": "Somatic Mutation",
"drug_interaction_type": null,
"status": "accepted",
"open_change_count": 0,
"type": "evidence",
"source": {
"id": 52,
"name": "A great majority of GISTs with PDGFRA mutations represent gastric tumors of low or no malignant potential.",
"citation": "Lasota et al., 2004, Lab. Invest.",
"pubmed_id": "15146165",
"source_url": "http://www.ncbi.nlm.nih.gov/pubmed/15146165",
"open_access": null,
"pmc_id": null,
"publication_date": {
"year": 2004,
"month": 7
},
"journal": "Lab. Invest.",
"full_journal_title": "Laboratory investigation; a journal of technical methods and pathology",
"status": "fully curated"
},
"variant_id": 99
},
]
}
This endpoint returns a listing of evidence items in CIViC. This index style endpoint is paginated by default. You can use the count and page parameters or the previous and next links to iterate through all the evidence items.
HTTP Request
GET https://civicdb.org/api/evidence_items
Query Parameters
| Parameter | Default | Description |
|---|---|---|
| page | 1 | Which page of results to return |
| count | 25 | How many variants to return on a single page |
Get details for a specific evidence item
curl https://civicdb.org/api/evidence_items/512
{
"id": 512,
"name": "EID512",
"description": "Nonsense mutations in SMARCA4 were associated with small cell carcinoma of the ovary, hypercalcemic type in 10/10 tumor samples, and were rarely found in other solid tumor types catalogued by TCGA.",
"disease": {
"id": 253,
"name": "Small Cell Carcinoma Of The Ovary Hypercalcemic Type",
"display_name": "Small Cell Carcinoma Of The Ovary Hypercalcemic Type",
"doid": "7651",
"url": "http://www.disease-ontology.org/?id=DOID:7651"
},
"drugs": [],
"rating": 5,
"evidence_level": "B",
"evidence_type": "Diagnostic",
"clinical_significance": "Positive",
"evidence_direction": "Supports",
"variant_origin": "Somatic Mutation",
"drug_interaction_type": null,
"status": "accepted",
"open_change_count": 0,
"type": "evidence",
"source": {
"id": 316,
"name": "Recurrent SMARCA4 mutations in small cell carcinoma of the ovary.",
"citation": "Jelinic et al., 2014, Nat. Genet.",
"pubmed_id": "24658004",
"source_url": "http://www.ncbi.nlm.nih.gov/pubmed/24658004",
"open_access": null,
"pmc_id": null,
"publication_date": {
"year": 2014,
"month": 5
},
"journal": "Nat. Genet.",
"full_journal_title": "Nature genetics",
"status": "fully curated"
},
"variant_id": 217,
"errors": {},
"lifecycle_actions": {
"accepted": {
"order": 1,
"timestamp": "2015-08-05T18:47:08.046Z",
"user": {
"id": 41,
"email": "nspies13@gmail.com",
"name": "Nick Spies",
"last_seen_at": "2016-12-02T22:15:09.110Z",
"username": "NickSpies",
"role": "admin",
"avatar_url": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Research Scientist",
"orcid": "",
"display_name": "NickSpies",
"created_at": "2015-06-12T18:13:16.508Z",
"url": "",
"twitter_handle": "@NickSpies13",
"facebook_profile": null,
"linkedin_profile": null,
"bio": "Nick Spies is a staff analyst at the McDonnell Genome Institute and an MD student at Washington University School of Medicine. He has made substantial contributions to the development of genome analysis tools and resources at the Genome Institute including the Drug-Gene Interaction Database. He is a founding member of the CIViC team, helping to define the CIViC data model, and a leading content curator and a feature development consultant.",
"featured_expert": true,
"accepted_license": null,
"signup_complete": null
}
}
},
"fields_with_pending_changes": {}
}
This endpoint retrieves details about a specific evidence item, given its internal CIViC id.
HTTP Request
GET https://civicdb.org/api/evidence_items/:id
Variant Groups
The variant groups endpoint allows users to enumerate all of the variant groups in CIViC and view their membership.
Get a list of variant groups
curl https://civicdb.org/api/variant_groups
{
"_meta": {
"current_page": 1,
"per_page": 20,
"total_pages": 1,
"total_count": 20,
"links": {
"next": null,
"previous": null
}
},
"records": [
{
"id": 1,
"name": "Imatinib Resistance",
"description": "While imatinib has shown to be incredibly successful in treating philadelphia chromosome positive CML, patients that have shown primary or secondary resistance to the drug have been observed to harbor T315I and E255K ABL kinase domain mutations. These mutations, among others, have been observed both in primary refractory disease and acquired resistance. In gastrointestinal stromal tumors (GIST), PDGFRA 842 mutations have also been shown to confer resistance to imatinib. ",
"variants": [
{
"id": 3,
"entrez_name": "ABL1",
"gene_id": 4,
"entrez_id": 25,
"name": "BCR-ABL E255K",
"description": "While the efficacy of imatinib has revolutionized chronic myelogenous leukemia (CML) treatment, it is still not a cure-all. Both initial resistance and acquired resistance as a result of selection have been seen in a small subset of CML patients. The ABL kinase domain mutation E255K has been shown to be one such mutation that confers resistance to imatinib. Second generation TKI's (dasatinib and nilotinib) specific to BCR-ABL have shown efficacy in treating resistant cases.",
"type": "variant",
"variant_types": [
{
"id": 120,
"name": "transcript_fusion",
"display_name": "Transcript Fusion",
"so_id": "SO:0001886",
"description": "A feature fusion where the deletion brings together transcript regions.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001886"
},
],
"evidence_items": {
"accepted_count": 1,
"rejected_count": 0,
"submitted_count": 0
},
"coordinates": {
"chromosome": "9",
"start": "133738363",
"stop": "133738363",
"reference_bases": "G",
"variant_bases": "A",
"representative_transcript": "ENST00000318560.5",
"chromosome2": null,
"start2": null,
"stop2": null,
"representative_transcript2": null,
"ensembl_version": 75,
"reference_build": "GRCh37"
}
},
{
"id": 101,
"entrez_name": "PDGFRA",
"gene_id": 38,
"entrez_id": 5156,
"name": "I843DEL",
"description": "PDGFRA D842 mutations are characterized broadly as imatinib resistance mutations. This is most well characterized in gastrointestinal stromal tumors, but other cell lines containing these mutations have been shown to be resistant as well. In imatinib resistant cell lines, a number of other therapeutics have demonstrated efficacy. These include; crenolanib, sirolimus, and midostaurin (PKC412).",
"type": "variant",
"variant_types": [
{
"id": 107,
"name": "inframe_deletion",
"display_name": "Inframe Deletion",
"so_id": "SO:0001822",
"description": "An inframe non synonymous variant that deletes bases from the coding sequence.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001822"
}
],
"evidence_items": {
"accepted_count": 2,
"rejected_count": 0,
"submitted_count": 0
},
"coordinates": {
"chromosome": "4",
"start": "55152095",
"stop": "55152097",
"reference_bases": "ATC",
"variant_bases": null,
"representative_transcript": "ENST00000257290.5",
"chromosome2": null,
"start2": null,
"stop2": null,
"representative_transcript2": null,
"ensembl_version": 75,
"reference_build": "GRCh37"
}
},
{
"id": 102,
"entrez_name": "PDGFRA",
"gene_id": 38,
"entrez_id": 5156,
"name": "DI842-843VM",
"description": "PDGFRA D842 mutations are characterized broadly as imatinib resistance mutations. The DI842-843VM variant is the result of a double point mutation. This is most well characterized in gastrointestinal stromal tumors, but other cell lines containing these mutations have been shown to be resistant as well. In imatinib resistant cell lines, a number of other therapeutics have demonstrated efficacy. These include; crenolanib, sirolimus, and midostaurin (PKC412).",
"type": "variant",
"variant_types": [
{
"id": 47,
"name": "missense_variant",
"display_name": "Missense Variant",
"so_id": "SO:0001583",
"description": "A sequence variant, that changes one or more bases, resulting in a different amino acid sequence but where the length is preserved.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001583"
}
],
"evidence_items": {
"accepted_count": 1,
"rejected_count": 0,
"submitted_count": 0
},
"coordinates": {
"chromosome": "4",
"start": "55152093",
"stop": "55152097",
"reference_bases": "ACATC",
"variant_bases": "TCATG",
"representative_transcript": "ENST00000257290.5",
"chromosome2": null,
"start2": null,
"stop2": null,
"representative_transcript2": null,
"ensembl_version": 75,
"reference_build": "GRCh37"
}
},
{
"id": 98,
"entrez_name": "PDGFRA",
"gene_id": 38,
"entrez_id": 5156,
"name": "D842I",
"description": "PDGFRA D842 mutations are characterized broadly as imatinib resistance mutations. This is most well characterized in gastrointestinal stromal tumors, but other cell lines containing these mutations have been shown to be resistant as well. In imatinib resistant cell lines, a number of other therapeutics have demonstrated efficacy. These include; crenolanib, sirolimus, and midostaurin (PKC412).",
"type": "variant",
"variant_types": [
{
"id": 47,
"name": "missense_variant",
"display_name": "Missense Variant",
"so_id": "SO:0001583",
"description": "A sequence variant, that changes one or more bases, resulting in a different amino acid sequence but where the length is preserved.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001583"
}
],
"evidence_items": {
"accepted_count": 1,
"rejected_count": 0,
"submitted_count": 0
},
"coordinates": {
"chromosome": "4",
"start": "55152092",
"stop": "55152093",
"reference_bases": "GA",
"variant_bases": "AT",
"representative_transcript": "ENST00000257290.5",
"chromosome2": null,
"start2": null,
"stop2": null,
"representative_transcript2": null,
"ensembl_version": 75,
"reference_build": "GRCh37"
}
},
],
"type": "variant_group"
},
]
}
This endpoint returns a listing of variant groups in CIViC. This index style endpoint is paginated by default. You can use the count and page parameters or the previous and next links to iterate through all the variant groups.
HTTP Request
GET https://civicdb.org/api/variant_groups
Query Parameters
| Parameter | Default | Description |
|---|---|---|
| page | 1 | Which page of results to return |
| count | 25 | How many variants to return on a single page |
Get details for a specific variant group
curl https://civicdb.org/api/variant_groups/1
{
"id": 1,
"name": "Imatinib Resistance",
"description": "While imatinib has shown to be incredibly successful in treating philadelphia chromosome positive CML, patients that have shown primary or secondary resistance to the drug have been observed to harbor T315I and E255K ABL kinase domain mutations. These mutations, among others, have been observed both in primary refractory disease and acquired resistance. In gastrointestinal stromal tumors (GIST), PDGFRA 842 mutations have also been shown to confer resistance to imatinib. ",
"variants": [
{
"id": 3,
"entrez_name": "ABL1",
"gene_id": 4,
"entrez_id": 25,
"name": "BCR-ABL E255K",
"description": "While the efficacy of imatinib has revolutionized chronic myelogenous leukemia (CML) treatment, it is still not a cure-all. Both initial resistance and acquired resistance as a result of selection have been seen in a small subset of CML patients. The ABL kinase domain mutation E255K has been shown to be one such mutation that confers resistance to imatinib. Second generation TKI's (dasatinib and nilotinib) specific to BCR-ABL have shown efficacy in treating resistant cases.",
"type": "variant",
"variant_types": [
{
"id": 120,
"name": "transcript_fusion",
"display_name": "Transcript Fusion",
"so_id": "SO:0001886",
"description": "A feature fusion where the deletion brings together transcript regions.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001886"
},
{
"id": 47,
"name": "missense_variant",
"display_name": "Missense Variant",
"so_id": "SO:0001583",
"description": "A sequence variant, that changes one or more bases, resulting in a different amino acid sequence but where the length is preserved.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001583"
}
],
"evidence_items": {
"accepted_count": 1,
"rejected_count": 0,
"submitted_count": 0
},
"coordinates": {
"chromosome": "9",
"start": "133738363",
"stop": "133738363",
"reference_bases": "G",
"variant_bases": "A",
"representative_transcript": "ENST00000318560.5",
"chromosome2": null,
"start2": null,
"stop2": null,
"representative_transcript2": null,
"ensembl_version": 75,
"reference_build": "GRCh37"
},
"variant_groups": [
{
"id": 1,
"name": "Imatinib Resistance",
"description": "While imatinib has shown to be incredibly successful in treating philadelphia chromosome positive CML, patients that have shown primary or secondary resistance to the drug have been observed to harbor T315I and E255K ABL kinase domain mutations. These mutations, among others, have been observed both in primary refractory disease and acquired resistance. In gastrointestinal stromal tumors (GIST), PDGFRA 842 mutations have also been shown to confer resistance to imatinib. ",
"variants": [
{
"id": 2,
"entrez_name": "ABL1",
"gene_id": 4,
"entrez_id": 25,
"name": "BCR-ABL T334I",
"description": "While the efficacy of imatinib has revolutionized chronic myelogenous leukemia (CML) treatment, it is still not a cure-all. Both initial resistance and acquired resistance as a result of selection have been seen in a small subset of CML patients. The ABL kinase domain mutation T315I (aka T334I) has been shown to be one such mutation that confers resistance to imatinib. Second generation TKI's (dasatinib and ponatinib) specific to BCR-ABL have shown efficacy in treating resistant cases.",
"type": "variant",
"variant_types": [
{
"id": 47,
"name": "missense_variant",
"display_name": "Missense Variant",
"so_id": "SO:0001583",
"description": "A sequence variant, that changes one or more bases, resulting in a different amino acid sequence but where the length is preserved.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001583"
},
{
"id": 120,
"name": "transcript_fusion",
"display_name": "Transcript Fusion",
"so_id": "SO:0001886",
"description": "A feature fusion where the deletion brings together transcript regions.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001886"
}
],
"evidence_items": {
"accepted_count": 3,
"rejected_count": 0,
"submitted_count": 0
},
"coordinates": {
"chromosome": "9",
"start": "133748283",
"stop": "133748283",
"reference_bases": "C",
"variant_bases": "T",
"representative_transcript": "ENST00000372348.2",
"chromosome2": null,
"start2": null,
"stop2": null,
"representative_transcript2": null,
"ensembl_version": 75,
"reference_build": "GRCh37"
}
},
{
"id": 3,
"entrez_name": "ABL1",
"gene_id": 4,
"entrez_id": 25,
"name": "BCR-ABL E255K",
"description": "While the efficacy of imatinib has revolutionized chronic myelogenous leukemia (CML) treatment, it is still not a cure-all. Both initial resistance and acquired resistance as a result of selection have been seen in a small subset of CML patients. The ABL kinase domain mutation E255K has been shown to be one such mutation that confers resistance to imatinib. Second generation TKI's (dasatinib and nilotinib) specific to BCR-ABL have shown efficacy in treating resistant cases.",
"type": "variant",
"variant_types": [
{
"id": 47,
"name": "missense_variant",
"display_name": "Missense Variant",
"so_id": "SO:0001583",
"description": "A sequence variant, that changes one or more bases, resulting in a different amino acid sequence but where the length is preserved.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001583"
},
{
"id": 120,
"name": "transcript_fusion",
"display_name": "Transcript Fusion",
"so_id": "SO:0001886",
"description": "A feature fusion where the deletion brings together transcript regions.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001886"
}
],
"evidence_items": {
"accepted_count": 1,
"rejected_count": 0,
"submitted_count": 0
},
"coordinates": {
"chromosome": "9",
"start": "133738363",
"stop": "133738363",
"reference_bases": "G",
"variant_bases": "A",
"representative_transcript": "ENST00000318560.5",
"chromosome2": null,
"start2": null,
"stop2": null,
"representative_transcript2": null,
"ensembl_version": 75,
"reference_build": "GRCh37"
}
},
{
"id": 98,
"entrez_name": "PDGFRA",
"gene_id": 38,
"entrez_id": 5156,
"name": "D842I",
"description": "PDGFRA D842 mutations are characterized broadly as imatinib resistance mutations. This is most well characterized in gastrointestinal stromal tumors, but other cell lines containing these mutations have been shown to be resistant as well. In imatinib resistant cell lines, a number of other therapeutics have demonstrated efficacy. These include; crenolanib, sirolimus, and midostaurin (PKC412).",
"type": "variant",
"variant_types": [
{
"id": 47,
"name": "missense_variant",
"display_name": "Missense Variant",
"so_id": "SO:0001583",
"description": "A sequence variant, that changes one or more bases, resulting in a different amino acid sequence but where the length is preserved.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001583"
}
],
"evidence_items": {
"accepted_count": 1,
"rejected_count": 0,
"submitted_count": 0
},
"coordinates": {
"chromosome": "4",
"start": "55152092",
"stop": "55152093",
"reference_bases": "GA",
"variant_bases": "AT",
"representative_transcript": "ENST00000257290.5",
"chromosome2": null,
"start2": null,
"stop2": null,
"representative_transcript2": null,
"ensembl_version": 75,
"reference_build": "GRCh37"
}
},
{
"id": 99,
"entrez_name": "PDGFRA",
"gene_id": 38,
"entrez_id": 5156,
"name": "D842V",
"description": "PDGFRA D842 mutations are characterized broadly as imatinib resistance mutations. This is most well characterized in gastrointestinal stromal tumors, but other cell lines containing these mutations have been shown to be resistant as well. Exogenous expression of the A842V mutation resulted in constitutive tyrosine phosphorylation of PDGFRA in the absence of ligand in 293T cells and cytokine-independent proliferation of the IL-3-dependent Ba/F3 cell line, both evidence that this is an activating mutation. In imatinib resistant cell lines, a number of other therapeutics have demonstrated efficacy. These include; crenolanib, sirolimus, and midostaurin (PKC412).",
"type": "variant",
"variant_types": [
{
"id": 47,
"name": "missense_variant",
"display_name": "Missense Variant",
"so_id": "SO:0001583",
"description": "A sequence variant, that changes one or more bases, resulting in a different amino acid sequence but where the length is preserved.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001583"
}
],
"evidence_items": {
"accepted_count": 6,
"rejected_count": 0,
"submitted_count": 0
},
"coordinates": {
"chromosome": "4",
"start": "55152093",
"stop": "55152093",
"reference_bases": "A",
"variant_bases": "T",
"representative_transcript": "ENST00000257290.5",
"chromosome2": null,
"start2": null,
"stop2": null,
"representative_transcript2": null,
"ensembl_version": 75,
"reference_build": "GRCh37"
}
},
{
"id": 100,
"entrez_name": "PDGFRA",
"gene_id": 38,
"entrez_id": 5156,
"name": "D842Y",
"description": "PDGFRA D842 mutations are characterized broadly as imatinib resistance mutations. This is most well characterized in gastrointestinal stromal tumors, but other cell lines containing these mutations have been shown to be resistant as well. In imatinib resistant cell lines, a number of other therapeutics have demonstrated efficacy. These include; crenolanib, sirolimus, and midostaurin (PKC412).",
"type": "variant",
"variant_types": [
{
"id": 47,
"name": "missense_variant",
"display_name": "Missense Variant",
"so_id": "SO:0001583",
"description": "A sequence variant, that changes one or more bases, resulting in a different amino acid sequence but where the length is preserved.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001583"
}
],
"evidence_items": {
"accepted_count": 1,
"rejected_count": 0,
"submitted_count": 0
},
"coordinates": {
"chromosome": "4",
"start": "55152092",
"stop": "55152092",
"reference_bases": "G",
"variant_bases": "T",
"representative_transcript": "ENST00000257290.5",
"chromosome2": null,
"start2": null,
"stop2": null,
"representative_transcript2": null,
"ensembl_version": 75,
"reference_build": "GRCh37"
}
},
{
"id": 101,
"entrez_name": "PDGFRA",
"gene_id": 38,
"entrez_id": 5156,
"name": "I843DEL",
"description": "PDGFRA D842 mutations are characterized broadly as imatinib resistance mutations. This is most well characterized in gastrointestinal stromal tumors, but other cell lines containing these mutations have been shown to be resistant as well. In imatinib resistant cell lines, a number of other therapeutics have demonstrated efficacy. These include; crenolanib, sirolimus, and midostaurin (PKC412).",
"type": "variant",
"variant_types": [
{
"id": 107,
"name": "inframe_deletion",
"display_name": "Inframe Deletion",
"so_id": "SO:0001822",
"description": "An inframe non synonymous variant that deletes bases from the coding sequence.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001822"
}
],
"evidence_items": {
"accepted_count": 2,
"rejected_count": 0,
"submitted_count": 0
},
"coordinates": {
"chromosome": "4",
"start": "55152095",
"stop": "55152097",
"reference_bases": "ATC",
"variant_bases": null,
"representative_transcript": "ENST00000257290.5",
"chromosome2": null,
"start2": null,
"stop2": null,
"representative_transcript2": null,
"ensembl_version": 75,
"reference_build": "GRCh37"
}
},
{
"id": 102,
"entrez_name": "PDGFRA",
"gene_id": 38,
"entrez_id": 5156,
"name": "DI842-843VM",
"description": "PDGFRA D842 mutations are characterized broadly as imatinib resistance mutations. The DI842-843VM variant is the result of a double point mutation. This is most well characterized in gastrointestinal stromal tumors, but other cell lines containing these mutations have been shown to be resistant as well. In imatinib resistant cell lines, a number of other therapeutics have demonstrated efficacy. These include; crenolanib, sirolimus, and midostaurin (PKC412).",
"type": "variant",
"variant_types": [
{
"id": 47,
"name": "missense_variant",
"display_name": "Missense Variant",
"so_id": "SO:0001583",
"description": "A sequence variant, that changes one or more bases, resulting in a different amino acid sequence but where the length is preserved.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001583"
}
],
"evidence_items": {
"accepted_count": 1,
"rejected_count": 0,
"submitted_count": 0
},
"coordinates": {
"chromosome": "4",
"start": "55152093",
"stop": "55152097",
"reference_bases": "ACATC",
"variant_bases": "TCATG",
"representative_transcript": "ENST00000257290.5",
"chromosome2": null,
"start2": null,
"stop2": null,
"representative_transcript2": null,
"ensembl_version": 75,
"reference_build": "GRCh37"
}
},
{
"id": 241,
"entrez_name": "ABL1",
"gene_id": 4,
"entrez_id": 25,
"name": "BCR-ABL F317L",
"description": "BCR-ABL F317L, like the similar BCR-ABL T315I mutation, is becoming a common clinical marker for resistance to front-line therapies in CML. It has been shown to confer resistance to dasatinib, but responds well to ponatinib and other second generation inhibitors.",
"type": "variant",
"variant_types": [
{
"id": 47,
"name": "missense_variant",
"display_name": "Missense Variant",
"so_id": "SO:0001583",
"description": "A sequence variant, that changes one or more bases, resulting in a different amino acid sequence but where the length is preserved.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001583"
},
{
"id": 120,
"name": "transcript_fusion",
"display_name": "Transcript Fusion",
"so_id": "SO:0001886",
"description": "A feature fusion where the deletion brings together transcript regions.",
"url": "http://www.sequenceontology.org/browser/current_svn/term/SO:0001886"
}
],
"evidence_items": {
"accepted_count": 3,
"rejected_count": 0,
"submitted_count": 0
},
"coordinates": {
"chromosome": "9",
"start": "133748288",
"stop": "133748288",
"reference_bases": "T",
"variant_bases": "C",
"representative_transcript": "ENST00000318560.5",
"chromosome2": null,
"start2": null,
"stop2": null,
"representative_transcript2": null,
"ensembl_version": 75,
"reference_build": "GRCh37"
}
}
],
"type": "variant_group"
}
]
}
],
"type": "variant_group",
"lifecycle_actions": {
"created": {
"order": 1,
"timestamp": "2015-06-21T16:49:38.943Z",
"user": {
"id": 41,
"email": "nspies13@gmail.com",
"name": "Nick Spies",
"last_seen_at": "2016-12-02T22:15:09.110Z",
"username": "NickSpies",
"role": "admin",
"avatar_url": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Research Scientist",
"orcid": "",
"display_name": "NickSpies",
"created_at": "2015-06-12T18:13:16.508Z",
"url": "",
"twitter_handle": "@NickSpies13",
"facebook_profile": null,
"linkedin_profile": null,
"bio": "Nick Spies is a staff analyst at the McDonnell Genome Institute and an MD student at Washington University School of Medicine. He has made substantial contributions to the development of genome analysis tools and resources at the Genome Institute including the Drug-Gene Interaction Database. He is a founding member of the CIViC team, helping to define the CIViC data model, and a leading content curator and a feature development consultant.",
"featured_expert": true,
"accepted_license": null,
"signup_complete": null
}
}
},
"sources": []
}
This endpoint retrieves details about a specific variant group, given its internal CIViC id.
HTTP Request
GET https://civicdb.org/api/variant_groups/:id
Assertions
The assertions endpoint allows users to enumerate all of the assertions present in CIViC as well as retrieve more detailed information on a specific assertion. This is the endpoint that should be used to obtain a complete listing of every assertion in CIViC.
Get a list of assertions
curl https://civicdb.org/api/assertions
{
"_meta": {
"current_page": 1,
"per_page": 6,
"total_pages": 1,
"total_count": 6,
"links": {
"next": null,
"previous": null
}
},
"records": [
{
"id": 1,
"type": "assertion",
"name": "AID1",
"summary": "HER2 amplification predicts sensitivity to Trastuzumab",
"description": "HER2 amplification defines a clinically relevant subtype of breast cancer. HER2 amplification predicts sensitivity to various targeted therapies including the monoclonal antibody Trastuzumab. The use of Trastuzumab, often in combination with chemotherapy and/or endocrine therapy (depending on hormone receptor status), is now standard of care for HER2-positive breast cancer patients.",
"gene": {
"name": "ERBB2",
"id": 20
},
"variant": {
"name": "AMPLIFICATION",
"id": 306
},
"disease": {
"id": 368,
"name": "Her2-receptor Positive Breast Cancer",
"display_name": "Her2-receptor Positive Breast Cancer",
"doid": "0060079",
"url": "http://www.disease-ontology.org/?id=DOID:0060079"
},
"drugs": [
{
"id": 84,
"name": "Trastuzumab",
"pubchem_id": null
}
],
"evidence_type": "Predictive",
"evidence_direction": "Supports",
"clinical_significance": "Sensitivity",
"evidence_item_count": 3,
"fda_regulatory_approval": true,
"status": "rejected",
"open_change_count": 0,
"pending_evidence_count": 0
},
{
"id": 2,
"type": "assertion",
"name": "AID2",
"summary": "HER2 amplification predicts sensitivity to Trastuzumab",
"description": "HER2 amplification defines a clinically relevant subtype of breast cancer. HER2 amplification predicts sensitivity to various targeted therapies including the monoclonal antibody Trastuzumab. The use of Trastuzumab, often in combination with chemotherapy and/or endocrine therapy (depending on hormone receptor status), is now standard of care for HER2-positive breast cancer patients.",
"gene": {
"name": "ERBB2",
"id": 20
},
"variant": {
"name": "AMPLIFICATION",
"id": 306
},
"disease": {
"id": 368,
"name": "Her2-receptor Positive Breast Cancer",
"display_name": "Her2-receptor Positive Breast Cancer",
"doid": "0060079",
"url": "http://www.disease-ontology.org/?id=DOID:0060079"
},
"drugs": [
{
"id": 84,
"name": "Trastuzumab",
"pubchem_id": null
}
],
"evidence_type": "Predictive",
"evidence_direction": "Supports",
"clinical_significance": "Sensitivity",
"evidence_item_count": 3,
"fda_regulatory_approval": true,
"status": "accepted",
"open_change_count": 0,
"pending_evidence_count": 0
}
]
}
This endpoint returns a listing of assertions in CIViC. This index style endpoint is paginated by default. You can use the count and page parameters or the previous and next links to iterate through all the assertions.
HTTP Request
GET https://civicdb.org/api/assertions
Query Parameters
| Parameter | Default | Description |
|---|---|---|
| page | 1 | Which page of results to return |
| count | 25 | How many assertions to return on a single page |
Get details for a specific assertion
curl https://civicdb.org/api/assertions/2
{
"id": 2,
"type": "assertion",
"name": "AID2",
"summary": "HER2 amplification predicts sensitivity to Trastuzumab",
"description": "HER2 amplification defines a clinically relevant subtype of breast cancer. HER2 amplification predicts sensitivity to various targeted therapies including the monoclonal antibody Trastuzumab. The use of Trastuzumab, often in combination with chemotherapy and/or endocrine therapy (depending on hormone receptor status), is now standard of care for HER2-positive breast cancer patients.",
"gene": {
"name": "ERBB2",
"id": 20
},
"variant": {
"name": "AMPLIFICATION",
"id": 306
},
"disease": {
"id": 368,
"name": "Her2-receptor Positive Breast Cancer",
"display_name": "Her2-receptor Positive Breast Cancer",
"doid": "0060079",
"url": "http://www.disease-ontology.org/?id=DOID:0060079"
},
"drugs": [
{
"id": 84,
"name": "Trastuzumab",
"pubchem_id": null
}
],
"evidence_type": "Predictive",
"evidence_direction": "Supports",
"clinical_significance": "Sensitivity",
"evidence_item_count": 3,
"fda_regulatory_approval": true,
"status": "accepted",
"open_change_count": 0,
"pending_evidence_count": 0,
"nccn_guideline": "Breast Cancer",
"nccn_guideline_version": "3.2017",
"amp_level": "Tier I - Level A",
"evidence_items": [
{
"id": 528,
"name": "EID528",
"description": "A randomized clinical trial of 469 patients with previously untreated, HER2-positive, metastatic breast cancer demonstrated improved time to disease progression, objective response rate, and duration of response for patients who received trastuzumab in addition to chemotherapy compared to chemotherapy alone.",
"disease": {
"id": 368,
"name": "Her2-receptor Positive Breast Cancer",
"display_name": "Her2-receptor Positive Breast Cancer",
"doid": "0060079",
"url": "http://www.disease-ontology.org/?id=DOID:0060079"
},
"drugs": [
{
"id": 84,
"name": "Trastuzumab",
"pubchem_id": null
}
],
"rating": 5,
"evidence_level": "B",
"evidence_type": "Predictive",
"clinical_significance": "Sensitivity",
"evidence_direction": "Supports",
"variant_origin": "Somatic Mutation",
"drug_interaction_type": null,
"status": "accepted",
"open_change_count": 0,
"type": "evidence",
"source": {
"id": 328,
"name": "Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2.",
"citation": "Slamon et al., 2001, N. Engl. J. Med.",
"pubmed_id": "11248153",
"source_url": "http://www.ncbi.nlm.nih.gov/pubmed/11248153",
"open_access": null,
"pmc_id": null,
"publication_date": {
"year": 2001,
"month": 3,
"day": 15
},
"journal": "N. Engl. J. Med.",
"full_journal_title": "The New England journal of medicine",
"status": "fully curated",
"is_review": false,
"clinical_trials": []
},
"variant_id": 306,
"phenotypes": [],
"errors": {},
"lifecycle_actions": {
"submitted": {
"timestamp": "2015-08-25T15:42:25.527Z",
"user": {
"id": 3,
"name": "Obi Griffith",
"last_seen_at": "2018-02-28T17:11:03.923Z",
"username": "obigriffith",
"role": "admin",
"avatar_url": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Research Scientist",
"orcid": "0000-0002-0843-4271",
"display_name": "obigriffith",
"created_at": "2015-02-26T02:53:49.147Z",
"url": "http://genome.wustl.edu/people/individual/obi-griffith/",
"twitter_handle": "obigriffith",
"facebook_profile": "",
"linkedin_profile": "obigriffith",
"bio": "Dr. Griffith is Assistant Professor of Medicine and Assistant Director of the McDonnell Genome Institute at Washington University School of Medicine. He has worked in genomics and bioinformatics since the earliest phase of reference genome sequencing. He contributed to the Mammalian Gene Collection, producing some of the first full-length sequences for many human genes. He also was part of a small team of bioinformaticians that helped sequence and release the first whole genome reference sequence for the severe acute respiratory syndrome (SARS) virus at the height of the 2003 epidemic. He has contributed to the identification of molecular markers at the DNA, RNA and protein level that are useful for diagnosis and prognosis of thyroid, breast, lymphoma and other cancers. His lab’s research is focused on the development of informatics resources and personalized medicine strategies for cancer using genomic technologies. He is a co-creator of the CIViC resource.",
"featured_expert": true,
"accepted_license": null,
"signup_complete": null,
"affiliation": "",
"organization": {
"id": 1,
"name": "The McDonnell Genome Institute",
"url": "http://genome.wustl.edu/",
"description": "The McDonnell Genome Institute (MGI) is a world leader in the fast-paced, constantly changing field of genomics. A truly unique institution, we are pushing the limits of academic research by creating, testing, and implementing new approaches to the study of biology with the goal of understanding human health and disease, as well as evolution and the biology of other organisms.",
"profile_image": {
"x256": "/system/organizations/profile_images/000/000/001/x256/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x128": "/system/organizations/profile_images/000/000/001/x128/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x64": "/system/organizations/profile_images/000/000/001/x64/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x32": "/system/organizations/profile_images/000/000/001/x32/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x14": "/system/organizations/profile_images/000/000/001/x14/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976"
}
}
}
},
"last_modified": {
"timestamp": "2017-11-01T11:41:27.713Z",
"user": {
"id": 418,
"name": "Paul Roepman",
"last_seen_at": "2018-02-14T11:56:51.985Z",
"username": "PaulRoepman",
"role": "curator",
"avatar_url": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Clinical Scientist",
"orcid": "0000-0003-1566-0258",
"display_name": "PaulRoepman",
"created_at": "2017-04-04T11:32:56.753Z",
"url": null,
"twitter_handle": null,
"facebook_profile": null,
"linkedin_profile": "proepman",
"bio": "",
"featured_expert": false,
"accepted_license": null,
"signup_complete": null,
"affiliation": null,
"organization": {}
}
},
"last_reviewed": {
"timestamp": "2018-01-11T18:47:57.238Z",
"user": {
"id": 3,
"name": "Obi Griffith",
"last_seen_at": "2018-02-28T17:11:03.923Z",
"username": "obigriffith",
"role": "admin",
"avatar_url": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Research Scientist",
"orcid": "0000-0002-0843-4271",
"display_name": "obigriffith",
"created_at": "2015-02-26T02:53:49.147Z",
"url": "http://genome.wustl.edu/people/individual/obi-griffith/",
"twitter_handle": "obigriffith",
"facebook_profile": "",
"linkedin_profile": "obigriffith",
"bio": "Dr. Griffith is Assistant Professor of Medicine and Assistant Director of the McDonnell Genome Institute at Washington University School of Medicine. He has worked in genomics and bioinformatics since the earliest phase of reference genome sequencing. He contributed to the Mammalian Gene Collection, producing some of the first full-length sequences for many human genes. He also was part of a small team of bioinformaticians that helped sequence and release the first whole genome reference sequence for the severe acute respiratory syndrome (SARS) virus at the height of the 2003 epidemic. He has contributed to the identification of molecular markers at the DNA, RNA and protein level that are useful for diagnosis and prognosis of thyroid, breast, lymphoma and other cancers. His lab’s research is focused on the development of informatics resources and personalized medicine strategies for cancer using genomic technologies. He is a co-creator of the CIViC resource.",
"featured_expert": true,
"accepted_license": null,
"signup_complete": null,
"affiliation": "",
"organization": {
"id": 1,
"name": "The McDonnell Genome Institute",
"url": "http://genome.wustl.edu/",
"description": "The McDonnell Genome Institute (MGI) is a world leader in the fast-paced, constantly changing field of genomics. A truly unique institution, we are pushing the limits of academic research by creating, testing, and implementing new approaches to the study of biology with the goal of understanding human health and disease, as well as evolution and the biology of other organisms.",
"profile_image": {
"x256": "/system/organizations/profile_images/000/000/001/x256/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x128": "/system/organizations/profile_images/000/000/001/x128/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x64": "/system/organizations/profile_images/000/000/001/x64/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x32": "/system/organizations/profile_images/000/000/001/x32/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x14": "/system/organizations/profile_images/000/000/001/x14/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976"
}
}
}
},
"last_commented_on": {
"timestamp": "2017-11-01T10:55:28.039Z",
"user": {
"id": 418,
"name": "Paul Roepman",
"last_seen_at": "2018-02-14T11:56:51.985Z",
"username": "PaulRoepman",
"role": "curator",
"avatar_url": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Clinical Scientist",
"orcid": "0000-0003-1566-0258",
"display_name": "PaulRoepman",
"created_at": "2017-04-04T11:32:56.753Z",
"url": null,
"twitter_handle": null,
"facebook_profile": null,
"linkedin_profile": "proepman",
"bio": "",
"featured_expert": false,
"accepted_license": null,
"signup_complete": null,
"affiliation": null,
"organization": {}
}
},
"accepted": {
"timestamp": "2015-08-25T15:42:25.527Z",
"user": {
"id": 41,
"name": "Nick Spies",
"last_seen_at": "2018-02-13T20:09:25.261Z",
"username": "NickSpies",
"role": "admin",
"avatar_url": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Research Scientist",
"orcid": "",
"display_name": "NickSpies",
"created_at": "2015-06-12T18:13:16.508Z",
"url": "",
"twitter_handle": "@NickSpies13",
"facebook_profile": "",
"linkedin_profile": "",
"bio": "Nick Spies is a staff analyst at the McDonnell Genome Institute and an MD student at Washington University School of Medicine. He has made substantial contributions to the development of genome analysis tools and resources at the Genome Institute including the Drug-Gene Interaction Database. He is a founding member of the CIViC team, helping to define the CIViC data model, and a leading content curator and a feature development consultant.",
"featured_expert": true,
"accepted_license": null,
"signup_complete": null,
"affiliation": "",
"organization": {
"id": 1,
"name": "The McDonnell Genome Institute",
"url": "http://genome.wustl.edu/",
"description": "The McDonnell Genome Institute (MGI) is a world leader in the fast-paced, constantly changing field of genomics. A truly unique institution, we are pushing the limits of academic research by creating, testing, and implementing new approaches to the study of biology with the goal of understanding human health and disease, as well as evolution and the biology of other organisms.",
"profile_image": {
"x256": "/system/organizations/profile_images/000/000/001/x256/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x128": "/system/organizations/profile_images/000/000/001/x128/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x64": "/system/organizations/profile_images/000/000/001/x64/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x32": "/system/organizations/profile_images/000/000/001/x32/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x14": "/system/organizations/profile_images/000/000/001/x14/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976"
}
}
}
}
},
"fields_with_pending_changes": {},
"gene_id": 20,
"state_params": {
"evidence_item": {
"id": 528,
"name": "EID528"
},
"variant": {
"id": 306,
"name": "AMPLIFICATION"
},
"gene": {
"id": 20,
"name": "ERBB2"
}
}
},
{
"id": 529,
"name": "EID529",
"description": "A randomized clinical trial of 186 patients with previously untreated, HER2-positive, metastatic breast cancer demonstrated improved overall survival, response rate, response duration, time to progression, and time to treatment failure for patients who received trastuzumab in addition to chemotherapy (docetaxel) compared to chemotherapy alone.",
"disease": {
"id": 368,
"name": "Her2-receptor Positive Breast Cancer",
"display_name": "Her2-receptor Positive Breast Cancer",
"doid": "0060079",
"url": "http://www.disease-ontology.org/?id=DOID:0060079"
},
"drugs": [
{
"id": 84,
"name": "Trastuzumab",
"pubchem_id": null
}
],
"rating": 5,
"evidence_level": "B",
"evidence_type": "Predictive",
"clinical_significance": "Sensitivity",
"evidence_direction": "Supports",
"variant_origin": "Somatic Mutation",
"drug_interaction_type": null,
"status": "accepted",
"open_change_count": 0,
"type": "evidence",
"source": {
"id": 329,
"name": "Randomized phase II trial of the efficacy and safety of trastuzumab combined with docetaxel in patients with human epidermal growth factor receptor 2-positive metastatic breast cancer administered as first-line treatment: the M77001 study group.",
"citation": "Marty et al., 2005, J. Clin. Oncol.",
"pubmed_id": "15911866",
"source_url": "http://www.ncbi.nlm.nih.gov/pubmed/15911866",
"open_access": null,
"pmc_id": null,
"publication_date": {
"year": 2005,
"month": 7,
"day": 1
},
"journal": "J. Clin. Oncol.",
"full_journal_title": "Journal of clinical oncology : official journal of the American Society of Clinical Oncology",
"status": "fully curated",
"is_review": false,
"clinical_trials": []
},
"variant_id": 306,
"phenotypes": [],
"errors": {},
"lifecycle_actions": {
"submitted": {
"timestamp": "2015-08-25T16:20:01.514Z",
"user": {
"id": 3,
"name": "Obi Griffith",
"last_seen_at": "2018-02-28T17:11:03.923Z",
"username": "obigriffith",
"role": "admin",
"avatar_url": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Research Scientist",
"orcid": "0000-0002-0843-4271",
"display_name": "obigriffith",
"created_at": "2015-02-26T02:53:49.147Z",
"url": "http://genome.wustl.edu/people/individual/obi-griffith/",
"twitter_handle": "obigriffith",
"facebook_profile": "",
"linkedin_profile": "obigriffith",
"bio": "Dr. Griffith is Assistant Professor of Medicine and Assistant Director of the McDonnell Genome Institute at Washington University School of Medicine. He has worked in genomics and bioinformatics since the earliest phase of reference genome sequencing. He contributed to the Mammalian Gene Collection, producing some of the first full-length sequences for many human genes. He also was part of a small team of bioinformaticians that helped sequence and release the first whole genome reference sequence for the severe acute respiratory syndrome (SARS) virus at the height of the 2003 epidemic. He has contributed to the identification of molecular markers at the DNA, RNA and protein level that are useful for diagnosis and prognosis of thyroid, breast, lymphoma and other cancers. His lab’s research is focused on the development of informatics resources and personalized medicine strategies for cancer using genomic technologies. He is a co-creator of the CIViC resource.",
"featured_expert": true,
"accepted_license": null,
"signup_complete": null,
"affiliation": "",
"organization": {
"id": 1,
"name": "The McDonnell Genome Institute",
"url": "http://genome.wustl.edu/",
"description": "The McDonnell Genome Institute (MGI) is a world leader in the fast-paced, constantly changing field of genomics. A truly unique institution, we are pushing the limits of academic research by creating, testing, and implementing new approaches to the study of biology with the goal of understanding human health and disease, as well as evolution and the biology of other organisms.",
"profile_image": {
"x256": "/system/organizations/profile_images/000/000/001/x256/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x128": "/system/organizations/profile_images/000/000/001/x128/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x64": "/system/organizations/profile_images/000/000/001/x64/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x32": "/system/organizations/profile_images/000/000/001/x32/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x14": "/system/organizations/profile_images/000/000/001/x14/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976"
}
}
}
},
"last_modified": {
"timestamp": "2017-11-01T11:42:05.451Z",
"user": {
"id": 418,
"name": "Paul Roepman",
"last_seen_at": "2018-02-14T11:56:51.985Z",
"username": "PaulRoepman",
"role": "curator",
"avatar_url": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Clinical Scientist",
"orcid": "0000-0003-1566-0258",
"display_name": "PaulRoepman",
"created_at": "2017-04-04T11:32:56.753Z",
"url": null,
"twitter_handle": null,
"facebook_profile": null,
"linkedin_profile": "proepman",
"bio": "",
"featured_expert": false,
"accepted_license": null,
"signup_complete": null,
"affiliation": null,
"organization": {}
}
},
"last_reviewed": {
"timestamp": "2018-01-11T18:48:23.019Z",
"user": {
"id": 3,
"name": "Obi Griffith",
"last_seen_at": "2018-02-28T17:11:03.923Z",
"username": "obigriffith",
"role": "admin",
"avatar_url": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Research Scientist",
"orcid": "0000-0002-0843-4271",
"display_name": "obigriffith",
"created_at": "2015-02-26T02:53:49.147Z",
"url": "http://genome.wustl.edu/people/individual/obi-griffith/",
"twitter_handle": "obigriffith",
"facebook_profile": "",
"linkedin_profile": "obigriffith",
"bio": "Dr. Griffith is Assistant Professor of Medicine and Assistant Director of the McDonnell Genome Institute at Washington University School of Medicine. He has worked in genomics and bioinformatics since the earliest phase of reference genome sequencing. He contributed to the Mammalian Gene Collection, producing some of the first full-length sequences for many human genes. He also was part of a small team of bioinformaticians that helped sequence and release the first whole genome reference sequence for the severe acute respiratory syndrome (SARS) virus at the height of the 2003 epidemic. He has contributed to the identification of molecular markers at the DNA, RNA and protein level that are useful for diagnosis and prognosis of thyroid, breast, lymphoma and other cancers. His lab’s research is focused on the development of informatics resources and personalized medicine strategies for cancer using genomic technologies. He is a co-creator of the CIViC resource.",
"featured_expert": true,
"accepted_license": null,
"signup_complete": null,
"affiliation": "",
"organization": {
"id": 1,
"name": "The McDonnell Genome Institute",
"url": "http://genome.wustl.edu/",
"description": "The McDonnell Genome Institute (MGI) is a world leader in the fast-paced, constantly changing field of genomics. A truly unique institution, we are pushing the limits of academic research by creating, testing, and implementing new approaches to the study of biology with the goal of understanding human health and disease, as well as evolution and the biology of other organisms.",
"profile_image": {
"x256": "/system/organizations/profile_images/000/000/001/x256/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x128": "/system/organizations/profile_images/000/000/001/x128/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x64": "/system/organizations/profile_images/000/000/001/x64/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x32": "/system/organizations/profile_images/000/000/001/x32/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x14": "/system/organizations/profile_images/000/000/001/x14/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976"
}
}
}
},
"last_commented_on": {
"timestamp": "2017-11-01T10:55:46.360Z",
"user": {
"id": 418,
"name": "Paul Roepman",
"last_seen_at": "2018-02-14T11:56:51.985Z",
"username": "PaulRoepman",
"role": "curator",
"avatar_url": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Clinical Scientist",
"orcid": "0000-0003-1566-0258",
"display_name": "PaulRoepman",
"created_at": "2017-04-04T11:32:56.753Z",
"url": null,
"twitter_handle": null,
"facebook_profile": null,
"linkedin_profile": "proepman",
"bio": "",
"featured_expert": false,
"accepted_license": null,
"signup_complete": null,
"affiliation": null,
"organization": {}
}
},
"accepted": {
"timestamp": "2015-08-25T16:20:01.514Z",
"user": {
"id": 41,
"name": "Nick Spies",
"last_seen_at": "2018-02-13T20:09:25.261Z",
"username": "NickSpies",
"role": "admin",
"avatar_url": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Research Scientist",
"orcid": "",
"display_name": "NickSpies",
"created_at": "2015-06-12T18:13:16.508Z",
"url": "",
"twitter_handle": "@NickSpies13",
"facebook_profile": "",
"linkedin_profile": "",
"bio": "Nick Spies is a staff analyst at the McDonnell Genome Institute and an MD student at Washington University School of Medicine. He has made substantial contributions to the development of genome analysis tools and resources at the Genome Institute including the Drug-Gene Interaction Database. He is a founding member of the CIViC team, helping to define the CIViC data model, and a leading content curator and a feature development consultant.",
"featured_expert": true,
"accepted_license": null,
"signup_complete": null,
"affiliation": "",
"organization": {
"id": 1,
"name": "The McDonnell Genome Institute",
"url": "http://genome.wustl.edu/",
"description": "The McDonnell Genome Institute (MGI) is a world leader in the fast-paced, constantly changing field of genomics. A truly unique institution, we are pushing the limits of academic research by creating, testing, and implementing new approaches to the study of biology with the goal of understanding human health and disease, as well as evolution and the biology of other organisms.",
"profile_image": {
"x256": "/system/organizations/profile_images/000/000/001/x256/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x128": "/system/organizations/profile_images/000/000/001/x128/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x64": "/system/organizations/profile_images/000/000/001/x64/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x32": "/system/organizations/profile_images/000/000/001/x32/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x14": "/system/organizations/profile_images/000/000/001/x14/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976"
}
}
}
}
},
"fields_with_pending_changes": {},
"gene_id": 20,
"state_params": {
"evidence_item": {
"id": 529,
"name": "EID529"
},
"variant": {
"id": 306,
"name": "AMPLIFICATION"
},
"gene": {
"id": 20,
"name": "ERBB2"
}
}
},
{
"id": 1122,
"name": "EID1122",
"description": "HERA was a Phase III trial assessing application of trastuzumab in an extended adjuvant setting. Patients were HER2 positive with completely excised invasive BC, node positive or negative, and having undergone prior adjuvant or neo-adjuvant chemotherapy. In the 3 arm study patients were given trastuzumab courses of 1 year, 2 years, or untreated. At the first planned interim analysis, trastuzumab treatment for one year was compared with observation alone. A significant difference in disease-free survival was seen with 220 DFS events out of 1693 in the observation arm versus 127 DFS events out of 1694 in the 1 year trastuzumab arm. 1 year adjuvant trastuzumab is currently the standard of care.",
"disease": {
"id": 368,
"name": "Her2-receptor Positive Breast Cancer",
"display_name": "Her2-receptor Positive Breast Cancer",
"doid": "0060079",
"url": "http://www.disease-ontology.org/?id=DOID:0060079"
},
"drugs": [
{
"id": 84,
"name": "Trastuzumab",
"pubchem_id": null
}
],
"rating": 4,
"evidence_level": "A",
"evidence_type": "Predictive",
"clinical_significance": "Sensitivity",
"evidence_direction": "Supports",
"variant_origin": "Somatic Mutation",
"drug_interaction_type": null,
"status": "accepted",
"open_change_count": 0,
"type": "evidence",
"source": {
"id": 777,
"name": "Trastuzumab after adjuvant chemotherapy in HER2-positive breast cancer.",
"citation": "Piccart-Gebhart et al., 2005, N. Engl. J. Med.",
"pubmed_id": "16236737",
"source_url": "http://www.ncbi.nlm.nih.gov/pubmed/16236737",
"open_access": null,
"pmc_id": null,
"publication_date": {
"year": 2005,
"month": 10,
"day": 20
},
"journal": "N. Engl. J. Med.",
"full_journal_title": "The New England journal of medicine",
"status": "fully curated",
"is_review": false,
"clinical_trials": []
},
"variant_id": 306,
"phenotypes": [],
"errors": {},
"lifecycle_actions": {
"submitted": {
"timestamp": "2016-02-26T08:41:00.728Z",
"user": {
"id": 110,
"name": "Arpad Danos",
"last_seen_at": "2018-03-06T19:06:13.119Z",
"username": "arpaddanos",
"role": "admin",
"avatar_url": "https://secure.gravatar.com/avatar/45c2db32371a9f86e1f6190f57758d77.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/45c2db32371a9f86e1f6190f57758d77.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/45c2db32371a9f86e1f6190f57758d77.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/45c2db32371a9f86e1f6190f57758d77.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/45c2db32371a9f86e1f6190f57758d77.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Research Scientist",
"orcid": "",
"display_name": "arpaddanos",
"created_at": "2016-01-27T00:20:51.218Z",
"url": "",
"twitter_handle": "",
"facebook_profile": "",
"linkedin_profile": "",
"bio": "",
"featured_expert": false,
"accepted_license": null,
"signup_complete": null,
"affiliation": "",
"organization": {
"id": 1,
"name": "The McDonnell Genome Institute",
"url": "http://genome.wustl.edu/",
"description": "The McDonnell Genome Institute (MGI) is a world leader in the fast-paced, constantly changing field of genomics. A truly unique institution, we are pushing the limits of academic research by creating, testing, and implementing new approaches to the study of biology with the goal of understanding human health and disease, as well as evolution and the biology of other organisms.",
"profile_image": {
"x256": "/system/organizations/profile_images/000/000/001/x256/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x128": "/system/organizations/profile_images/000/000/001/x128/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x64": "/system/organizations/profile_images/000/000/001/x64/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x32": "/system/organizations/profile_images/000/000/001/x32/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x14": "/system/organizations/profile_images/000/000/001/x14/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976"
}
}
}
},
"last_modified": {
"timestamp": "2017-11-01T11:40:09.927Z",
"user": {
"id": 418,
"name": "Paul Roepman",
"last_seen_at": "2018-02-14T11:56:51.985Z",
"username": "PaulRoepman",
"role": "curator",
"avatar_url": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Clinical Scientist",
"orcid": "0000-0003-1566-0258",
"display_name": "PaulRoepman",
"created_at": "2017-04-04T11:32:56.753Z",
"url": null,
"twitter_handle": null,
"facebook_profile": null,
"linkedin_profile": "proepman",
"bio": "",
"featured_expert": false,
"accepted_license": null,
"signup_complete": null,
"affiliation": null,
"organization": {}
}
},
"last_reviewed": {
"timestamp": "2017-12-04T15:42:23.750Z",
"user": {
"id": 179,
"name": "Erica Barnell",
"last_seen_at": "2018-03-05T15:46:24.463Z",
"username": "ebarnell",
"role": "admin",
"avatar_url": "https://secure.gravatar.com/avatar/b9800d871c67538acd31728e8f509c80.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/b9800d871c67538acd31728e8f509c80.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/b9800d871c67538acd31728e8f509c80.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/b9800d871c67538acd31728e8f509c80.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/b9800d871c67538acd31728e8f509c80.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Research Scientist",
"orcid": "0000-0003-1631-1201",
"display_name": "ebarnell",
"created_at": "2016-07-06T14:48:11.341Z",
"url": "",
"twitter_handle": "",
"facebook_profile": "",
"linkedin_profile": "https://www.linkedin.com/in/erica-barnell-72b16a60",
"bio": "",
"featured_expert": false,
"accepted_license": null,
"signup_complete": null,
"affiliation": "",
"organization": {
"id": 1,
"name": "The McDonnell Genome Institute",
"url": "http://genome.wustl.edu/",
"description": "The McDonnell Genome Institute (MGI) is a world leader in the fast-paced, constantly changing field of genomics. A truly unique institution, we are pushing the limits of academic research by creating, testing, and implementing new approaches to the study of biology with the goal of understanding human health and disease, as well as evolution and the biology of other organisms.",
"profile_image": {
"x256": "/system/organizations/profile_images/000/000/001/x256/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x128": "/system/organizations/profile_images/000/000/001/x128/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x64": "/system/organizations/profile_images/000/000/001/x64/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x32": "/system/organizations/profile_images/000/000/001/x32/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x14": "/system/organizations/profile_images/000/000/001/x14/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976"
}
}
}
},
"last_commented_on": {
"timestamp": "2017-11-01T10:54:47.582Z",
"user": {
"id": 418,
"name": "Paul Roepman",
"last_seen_at": "2018-02-14T11:56:51.985Z",
"username": "PaulRoepman",
"role": "curator",
"avatar_url": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/5e89a792925cb4b4e355c11a7b6c253d.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Clinical Scientist",
"orcid": "0000-0003-1566-0258",
"display_name": "PaulRoepman",
"created_at": "2017-04-04T11:32:56.753Z",
"url": null,
"twitter_handle": null,
"facebook_profile": null,
"linkedin_profile": "proepman",
"bio": "",
"featured_expert": false,
"accepted_license": null,
"signup_complete": null,
"affiliation": null,
"organization": {}
}
},
"accepted": {
"timestamp": "2016-02-26T14:59:53.268Z",
"user": {
"id": 41,
"name": "Nick Spies",
"last_seen_at": "2018-02-13T20:09:25.261Z",
"username": "NickSpies",
"role": "admin",
"avatar_url": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/3376aeb8439c5ab3e5d72fa2eeed39e5.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Research Scientist",
"orcid": "",
"display_name": "NickSpies",
"created_at": "2015-06-12T18:13:16.508Z",
"url": "",
"twitter_handle": "@NickSpies13",
"facebook_profile": "",
"linkedin_profile": "",
"bio": "Nick Spies is a staff analyst at the McDonnell Genome Institute and an MD student at Washington University School of Medicine. He has made substantial contributions to the development of genome analysis tools and resources at the Genome Institute including the Drug-Gene Interaction Database. He is a founding member of the CIViC team, helping to define the CIViC data model, and a leading content curator and a feature development consultant.",
"featured_expert": true,
"accepted_license": null,
"signup_complete": null,
"affiliation": "",
"organization": {
"id": 1,
"name": "The McDonnell Genome Institute",
"url": "http://genome.wustl.edu/",
"description": "The McDonnell Genome Institute (MGI) is a world leader in the fast-paced, constantly changing field of genomics. A truly unique institution, we are pushing the limits of academic research by creating, testing, and implementing new approaches to the study of biology with the goal of understanding human health and disease, as well as evolution and the biology of other organisms.",
"profile_image": {
"x256": "/system/organizations/profile_images/000/000/001/x256/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x128": "/system/organizations/profile_images/000/000/001/x128/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x64": "/system/organizations/profile_images/000/000/001/x64/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x32": "/system/organizations/profile_images/000/000/001/x32/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x14": "/system/organizations/profile_images/000/000/001/x14/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976"
}
}
}
}
},
"fields_with_pending_changes": {},
"gene_id": 20,
"state_params": {
"evidence_item": {
"id": 1122,
"name": "EID1122"
},
"variant": {
"id": 306,
"name": "AMPLIFICATION"
},
"gene": {
"id": 20,
"name": "ERBB2"
}
}
}
],
"acmg_codes": [],
"drug_interaction_type": null,
"fda_companion_test": true,
"allele_registry_id": null,
"phenotypes": [],
"variant_origin": null,
"lifecycle_actions": {
"submitted": {
"timestamp": "2018-01-11T19:34:41.434Z",
"user": {
"id": 3,
"name": "Obi Griffith",
"last_seen_at": "2018-02-28T17:11:03.923Z",
"username": "obigriffith",
"role": "admin",
"avatar_url": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/4c468e9a95d6135e02eb66ee5f2fb574.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Research Scientist",
"orcid": "0000-0002-0843-4271",
"display_name": "obigriffith",
"created_at": "2015-02-26T02:53:49.147Z",
"url": "http://genome.wustl.edu/people/individual/obi-griffith/",
"twitter_handle": "obigriffith",
"facebook_profile": "",
"linkedin_profile": "obigriffith",
"bio": "Dr. Griffith is Assistant Professor of Medicine and Assistant Director of the McDonnell Genome Institute at Washington University School of Medicine. He has worked in genomics and bioinformatics since the earliest phase of reference genome sequencing. He contributed to the Mammalian Gene Collection, producing some of the first full-length sequences for many human genes. He also was part of a small team of bioinformaticians that helped sequence and release the first whole genome reference sequence for the severe acute respiratory syndrome (SARS) virus at the height of the 2003 epidemic. He has contributed to the identification of molecular markers at the DNA, RNA and protein level that are useful for diagnosis and prognosis of thyroid, breast, lymphoma and other cancers. His lab’s research is focused on the development of informatics resources and personalized medicine strategies for cancer using genomic technologies. He is a co-creator of the CIViC resource.",
"featured_expert": true,
"accepted_license": null,
"signup_complete": null,
"affiliation": "",
"organization": {
"id": 1,
"name": "The McDonnell Genome Institute",
"url": "http://genome.wustl.edu/",
"description": "The McDonnell Genome Institute (MGI) is a world leader in the fast-paced, constantly changing field of genomics. A truly unique institution, we are pushing the limits of academic research by creating, testing, and implementing new approaches to the study of biology with the goal of understanding human health and disease, as well as evolution and the biology of other organisms.",
"profile_image": {
"x256": "/system/organizations/profile_images/000/000/001/x256/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x128": "/system/organizations/profile_images/000/000/001/x128/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x64": "/system/organizations/profile_images/000/000/001/x64/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x32": "/system/organizations/profile_images/000/000/001/x32/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x14": "/system/organizations/profile_images/000/000/001/x14/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976"
}
}
}
},
"last_commented_on": {
"timestamp": "2018-02-01T17:09:50.933Z",
"user": {
"id": 517,
"name": "Susanna Kiwala",
"last_seen_at": "2018-03-07T16:34:21.576Z",
"username": "susannakiwala",
"role": "admin",
"avatar_url": "https://secure.gravatar.com/avatar/d41d8cd98f00b204e9800998ecf8427e.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/3214c84f88bf30642f2de9ab8c5e1c7f.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/3214c84f88bf30642f2de9ab8c5e1c7f.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/3214c84f88bf30642f2de9ab8c5e1c7f.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/3214c84f88bf30642f2de9ab8c5e1c7f.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": null,
"orcid": "",
"display_name": "susannakiwala",
"created_at": "2017-08-03T19:20:57.776Z",
"url": "",
"twitter_handle": "",
"facebook_profile": "",
"linkedin_profile": "",
"bio": "",
"featured_expert": false,
"accepted_license": null,
"signup_complete": null,
"affiliation": "",
"organization": {
"id": 1,
"name": "The McDonnell Genome Institute",
"url": "http://genome.wustl.edu/",
"description": "The McDonnell Genome Institute (MGI) is a world leader in the fast-paced, constantly changing field of genomics. A truly unique institution, we are pushing the limits of academic research by creating, testing, and implementing new approaches to the study of biology with the goal of understanding human health and disease, as well as evolution and the biology of other organisms.",
"profile_image": {
"x256": "/system/organizations/profile_images/000/000/001/x256/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x128": "/system/organizations/profile_images/000/000/001/x128/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x64": "/system/organizations/profile_images/000/000/001/x64/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x32": "/system/organizations/profile_images/000/000/001/x32/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x14": "/system/organizations/profile_images/000/000/001/x14/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976"
}
}
}
},
"accepted": {
"timestamp": "2018-01-17T16:41:35.694Z",
"user": {
"id": 6,
"name": "Kilannin Krysiak",
"last_seen_at": "2018-03-06T23:19:03.508Z",
"username": "kkrysiak",
"role": "admin",
"avatar_url": "https://secure.gravatar.com/avatar/17180f9afc9f7f04fff97197c1ee5cb6.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/17180f9afc9f7f04fff97197c1ee5cb6.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/17180f9afc9f7f04fff97197c1ee5cb6.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/17180f9afc9f7f04fff97197c1ee5cb6.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/17180f9afc9f7f04fff97197c1ee5cb6.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Research Scientist",
"orcid": "0000-0002-6299-9230",
"display_name": "kkrysiak",
"created_at": "2015-02-26T04:14:20.953Z",
"url": "",
"twitter_handle": "",
"facebook_profile": "",
"linkedin_profile": "kilannin-krysiak-69047819",
"bio": "Dr. Krysiak is an Instructor at the McDonnell Genome Institute at Washington University School of Medicine where she is involved in the comprehensive genomic analysis of cancer patient cohorts and “n-of-1” studies. She received her PhD in Molecular Genetics and Genomics at Washington University in St. Louis where she focused on the genetics of myelodysplastic syndrome through advanced flow cytometry techniques, primary cell culture and mouse models. She is a founding member of the CIViC team, helping to define the CIViC data model, and a leading content curator and feature development consultant.",
"featured_expert": true,
"accepted_license": null,
"signup_complete": null,
"affiliation": "",
"organization": {
"id": 1,
"name": "The McDonnell Genome Institute",
"url": "http://genome.wustl.edu/",
"description": "The McDonnell Genome Institute (MGI) is a world leader in the fast-paced, constantly changing field of genomics. A truly unique institution, we are pushing the limits of academic research by creating, testing, and implementing new approaches to the study of biology with the goal of understanding human health and disease, as well as evolution and the biology of other organisms.",
"profile_image": {
"x256": "/system/organizations/profile_images/000/000/001/x256/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x128": "/system/organizations/profile_images/000/000/001/x128/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x64": "/system/organizations/profile_images/000/000/001/x64/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x32": "/system/organizations/profile_images/000/000/001/x32/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976",
"x14": "/system/organizations/profile_images/000/000/001/x14/MGI_STANDARD4_logo_brown-example_v1b.png?1494525976"
}
}
}
}
},
"provisional_values": {},
"errors": {}
}
This endpoint retrieves details about a specific assertion, given its internal CIViC id.
HTTP Request
GET https://civicdb.org/api/assertions/:id
Linking
For convenience, the CIViC API provides a method for linking to entities on the front end website using only a single identifier. This allows external integrations to build links to CIViC without needing an entire hierarchy of ids. The API supports two link formats, documented below, that behave identically.
These routes will return a 404 response if the provided ID is not found. Otherwise, they will return a 302 redirect to the canonical frontend link for the entity in question.
To link to the CIViC page for the Entrez Gene 1956 (EGFR) with the resource style format:
https://civicdb.org/links/entrez_id/1956
Resource Style Links:
Resource style links take the form of /links/:entity_type/:entity_id.
To link to the CIViC page for the variant with ID 12 (BRAF V600E) with the query parameter format:
https://civicdb.org/links?idtype=variant&id=12
Query Parameter Links:
Query parameter style links take the form of /links?idtype=:entity_type&id=:entity_id
CIViC supports the following entity and id types for generating shortned links:
| Entity Type | Description |
|---|---|
| gene | CIViC Gene ID |
| entrez_id | Entrez Gene ID |
| variant | CIViC Variant ID |
| allele_registry | Variant Allele Registry ID |
| evidence | CIViC Evidence ID |
| variant_group | CIViC Variant Group ID |
| assertion | CIViC Assertion ID |
| revision | CIViC Revision ID |
For more natural seeming resource based endpoints, the plural versions of the primary CViC entity types are also supported (genes, variants, evidence_items, variant_groups, assertions, revisions) and behave identically to their singular counterparts.
Metadata endpoints
All core CIViC entities support several metadata endpoints that allow users to view discussion, revision history, and moderation history.
These endpoints can be accessed by appending an additional path segment onto a detail view URL. For example, to see the discussion thread for the Variant with CIViC id 5, you could access the endpoint:
https://civicdb.org/api/variants/5/comments
Additionally, due to the hierarchical nature of CIViC entities, you can append the type of a child entity to the detail view of a parent entity in order to view the children.
For example, you could get all of the variants for a specific gene by querying https://civicdb.org/api/genes/:gene_id/variants
or all the evidence_items for a specific variant at the path https://civicdb.org/api/variants/:variant_id/evidence_items.
Endpoint Types
curl https://civicdb.org/api/genes/49/comments
[
{
"id": 247,
"text": "Note that there appears to be some confusion in the literature about the coordinates and nomenclature for WT1 mutations and the selection of representative transcripts. This may stem in part from the fact that “The WT1 gene encodes numerous protein isoforms. Two translational start sites have been identified, a standard methionine and a non-AUG leucine, which adds 68 amino-terminal residues” (http://genesdev.cshlp.org/content/12/20/3217.full). This confusion is propagated by the use of ambiguous terms \"Exon 7\" and \"Exon 9\" mutations in the literature, often used without additional information to help reduce ambiguity. To help clarify these variants, here are some representative primer sequences used to amplify \"Exon 7\" and \"Exon 9\" of WT1 (http://www.ncbi.nlm.nih.gov/pubmed/19221039).\n\n >7F\n CTCCAGTGCTCACTCTCCCTC\n >7R\n CCTTAGCAGTGTGAGAGCCTG\n >9F\n GTGAGGCAGATGCAGACATTG\n >9R\n AGCCACGCACTATTCCTTCTC",
"title": "",
"created_at": "2015-09-03T00:52:11.617Z",
"updated_at": "2015-09-03T00:52:11.617Z",
"user": {
"id": 15,
"email": "malachig@gmail.com",
"name": "Malachi Griffith",
"last_seen_at": "2017-01-05T21:29:19.166Z",
"username": "MalachiGriffith",
"role": "admin",
"avatar_url": "https://secure.gravatar.com/avatar/a4d9fc3b05d58cf3d3ba51dc30bb61d6.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/a4d9fc3b05d58cf3d3ba51dc30bb61d6.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/a4d9fc3b05d58cf3d3ba51dc30bb61d6.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/a4d9fc3b05d58cf3d3ba51dc30bb61d6.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/a4d9fc3b05d58cf3d3ba51dc30bb61d6.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Research Scientist",
"orcid": "0000-0002-6388-446X",
"display_name": "MalachiGriffith",
"created_at": "2015-02-26T22:25:34.692Z",
"url": "http://genome.wustl.edu/people/individual/malachi-griffith/",
"twitter_handle": "malachigriffith",
"facebook_profile": null,
"linkedin_profile": "malachigriffith",
"bio": "Dr. Griffith is an Assistant Professor of Genetics and Assistant Director of the McDonnell Genome Institute at Washington University School of Medicine. Dr Griffith has extensive experience in the fields of genomics, bioinformatics, data mining, and cancer research. His research is focused on improving the understanding of cancer biology and the development of personalized medicine strategies for cancer using genomics and informatics technologies. The Griffith lab develops bioinformatics and statistical methods for the analysis of high throughput sequence data and identification of biomarkers for diagnostic, prognostic and drug response prediction. The Griffith lab uses CIViC to interpret variants identified in cases examined by the WASHU Genomics Tumor Board. He is a co-creator of the CIViC resource.",
"featured_expert": true,
"accepted_license": null,
"signup_complete": null
},
"html": "<p>Note that there appears to be some confusion in the literature about the coordinates and nomenclature for WT1 mutations and the selection of representative transcripts. This may stem in part from the fact that “The WT1 gene encodes numerous protein isoforms. Two translational start sites have been identified, a standard methionine and a non-AUG leucine, which adds 68 amino-terminal residues” (<a href=\"http://genesdev.cshlp.org/content/12/20/3217.full\">http://genesdev.cshlp.org/content/12/20/3217.full</a>). This confusion is propagated by the use of ambiguous terms “Exon 7” and “Exon 9” mutations in the literature, often used without additional information to help reduce ambiguity. To help clarify these variants, here are some representative primer sequences used to amplify “Exon 7” and “Exon 9” of WT1 (<a href=\"http://www.ncbi.nlm.nih.gov/pubmed/19221039\">http://www.ncbi.nlm.nih.gov/pubmed/19221039</a>).</p>\n\n<pre><code>>7F\nCTCCAGTGCTCACTCTCCCTC\n>7R\nCCTTAGCAGTGTGAGAGCCTG\n>9F\nGTGAGGCAGATGCAGACATTG\n>9R\nAGCCACGCACTATTCCTTCTC\n</code></pre>\n"
},
{
"id": 249,
"text": "Renneville et al., 2009, Cancer (http://www.ncbi.nlm.nih.gov/pubmed/19536888)\n\n >7F-2\n CAGTGCTCACTCTCCCTCAA\n >7R-2 \n TAGCAGTGTGAGAGCCTGGA\n >9F-2\n TGCAGACATTGCAGGCATGGCAGG\n >9R-2\n GCACTATTCCTTCTCTCAACTGAG-3′\n\nVirappane et al., 2008, J. Clin. Oncol. (http://www.ncbi.nlm.nih.gov/pubmed/18591546)\n\n >7F-3\n GACCTACGTGAATGTTCACATG\n >7R-3\n ACCAACACCTGGATCAGACCT\n >9F-3\n TGCAGACATTGCAGGCATGGCAGG\n >9R-3\n GCACTATTCCTTCTCTCAACTGAG",
"title": "",
"created_at": "2015-09-03T01:16:55.412Z",
"updated_at": "2015-09-03T01:16:55.412Z",
"user": {
"id": 15,
"email": "malachig@gmail.com",
"name": "Malachi Griffith",
"last_seen_at": "2017-01-05T21:29:19.166Z",
"username": "MalachiGriffith",
"role": "admin",
"avatar_url": "https://secure.gravatar.com/avatar/a4d9fc3b05d58cf3d3ba51dc30bb61d6.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/a4d9fc3b05d58cf3d3ba51dc30bb61d6.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/a4d9fc3b05d58cf3d3ba51dc30bb61d6.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/a4d9fc3b05d58cf3d3ba51dc30bb61d6.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/a4d9fc3b05d58cf3d3ba51dc30bb61d6.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Research Scientist",
"orcid": "0000-0002-6388-446X",
"display_name": "MalachiGriffith",
"created_at": "2015-02-26T22:25:34.692Z",
"url": "http://genome.wustl.edu/people/individual/malachi-griffith/",
"twitter_handle": "malachigriffith",
"facebook_profile": null,
"linkedin_profile": "malachigriffith",
"bio": "Dr. Griffith is an Assistant Professor of Genetics and Assistant Director of the McDonnell Genome Institute at Washington University School of Medicine. Dr Griffith has extensive experience in the fields of genomics, bioinformatics, data mining, and cancer research. His research is focused on improving the understanding of cancer biology and the development of personalized medicine strategies for cancer using genomics and informatics technologies. The Griffith lab develops bioinformatics and statistical methods for the analysis of high throughput sequence data and identification of biomarkers for diagnostic, prognostic and drug response prediction. The Griffith lab uses CIViC to interpret variants identified in cases examined by the WASHU Genomics Tumor Board. He is a co-creator of the CIViC resource.",
"featured_expert": true,
"accepted_license": null,
"signup_complete": null
},
"html": "<p>Renneville et al., 2009, Cancer (<a href=\"http://www.ncbi.nlm.nih.gov/pubmed/19536888\">http://www.ncbi.nlm.nih.gov/pubmed/19536888</a>)</p>\n\n<pre><code>>7F-2\nCAGTGCTCACTCTCCCTCAA\n>7R-2 \nTAGCAGTGTGAGAGCCTGGA\n>9F-2\nTGCAGACATTGCAGGCATGGCAGG\n>9R-2\nGCACTATTCCTTCTCTCAACTGAG-3′\n</code></pre>\n\n<p>Virappane et al., 2008, J. Clin. Oncol. (<a href=\"http://www.ncbi.nlm.nih.gov/pubmed/18591546\">http://www.ncbi.nlm.nih.gov/pubmed/18591546</a>)</p>\n\n<pre><code>>7F-3\nGACCTACGTGAATGTTCACATG\n>7R-3\nACCAACACCTGGATCAGACCT\n>9F-3\nTGCAGACATTGCAGGCATGGCAGG\n>9R-3\nGCACTATTCCTTCTCTCAACTGAG\n</code></pre>\n"
},
{
"id": 250,
"text": "It looks like the three papers being used to obtain evidence items are possibly referring to a WT1 protein sequence that looks like this one:\nhttp://www.uniprot.org/blast/?about=P19544-1. Renneville et al., 2009, Cancer (http://www.ncbi.nlm.nih.gov/pubmed/19536888) actually refers to P19544 and NM_024426.",
"title": "",
"created_at": "2015-09-03T01:33:55.202Z",
"updated_at": "2015-09-03T01:33:55.202Z",
"user": {
"id": 15,
"email": "malachig@gmail.com",
"name": "Malachi Griffith",
"last_seen_at": "2017-01-05T21:29:19.166Z",
"username": "MalachiGriffith",
"role": "admin",
"avatar_url": "https://secure.gravatar.com/avatar/a4d9fc3b05d58cf3d3ba51dc30bb61d6.png?d=identicon&r=pg&s=32",
"avatars": {
"x128": "https://secure.gravatar.com/avatar/a4d9fc3b05d58cf3d3ba51dc30bb61d6.png?d=identicon&r=pg&s=128",
"x64": "https://secure.gravatar.com/avatar/a4d9fc3b05d58cf3d3ba51dc30bb61d6.png?d=identicon&r=pg&s=64",
"x32": "https://secure.gravatar.com/avatar/a4d9fc3b05d58cf3d3ba51dc30bb61d6.png?d=identicon&r=pg&s=32",
"x14": "https://secure.gravatar.com/avatar/a4d9fc3b05d58cf3d3ba51dc30bb61d6.png?d=identicon&r=pg&s=14"
},
"area_of_expertise": "Research Scientist",
"orcid": "0000-0002-6388-446X",
"display_name": "MalachiGriffith",
"created_at": "2015-02-26T22:25:34.692Z",
"url": "http://genome.wustl.edu/people/individual/malachi-griffith/",
"twitter_handle": "malachigriffith",
"facebook_profile": null,
"linkedin_profile": "malachigriffith",
"bio": "Dr. Griffith is an Assistant Professor of Genetics and Assistant Director of the McDonnell Genome Institute at Washington University School of Medicine. Dr Griffith has extensive experience in the fields of genomics, bioinformatics, data mining, and cancer research. His research is focused on improving the understanding of cancer biology and the development of personalized medicine strategies for cancer using genomics and informatics technologies. The Griffith lab develops bioinformatics and statistical methods for the analysis of high throughput sequence data and identification of biomarkers for diagnostic, prognostic and drug response prediction. The Griffith lab uses CIViC to interpret variants identified in cases examined by the WASHU Genomics Tumor Board. He is a co-creator of the CIViC resource.",
"featured_expert": true,
"accepted_license": null,
"signup_complete": null
},
"html": "<p>It looks like the three papers being used to obtain evidence items are possibly referring to a WT1 protein sequence that looks like this one:\n<a href=\"http://www.uniprot.org/blast/?about=P19544-1\">http://www.uniprot.org/blast/?about=P19544-1</a>. Renneville et al., 2009, Cancer (<a href=\"http://www.ncbi.nlm.nih.gov/pubmed/19536888\">http://www.ncbi.nlm.nih.gov/pubmed/19536888</a>) actually refers to P19544 and NM_024426.</p>\n"
}
]
| Endpoint | Purpose | Example |
|---|---|---|
/comments |
View discussion for an entity | /api/genes/1/comments |
/suggested_changes |
View proposed revisions for an entity | /api/genes/6/suggested_changes |
/revisions |
View the entire revision history for an entity. | /api/genes/6/revisions |
Supported endpoints for CIViC entities
| CIViC Entity | Base Path | Supported Endpoints |
|---|---|---|
| Genes | /api/genes/:gene_id |
/comments, /suggested_changes, /revisions, /variants |
| Variants | /api/variants/:variant_id |
/comments, /suggested_changes, /revisions, /evidence_items |
| Evidence Items | /api/evidence_items/:eid |
/comments, /suggested_changes, /revisions |
| Variant Groups | /api/variant_groups/:variant_group_id |
/comments, /suggested_changes, /revisions |
| Assertions | /api/assertions/:aid |
/comments, /suggested_changes, /revisions |
Throttling
In order to keep the CIViC API reliable, free, and open to all, we maintain some basic rate limits on its usage.
The default rate limit is approximately 2 requests/second calculated over a 5 minute moving window. That means you may burst substantially higher than 2 requests/second for short periods.
If you are hitting the rate limit, you will get a 429 Too Many Requests HTTP response. You will need to wait for that five minute window to elapse before making additional requests.
HTTP Headers
CIViC provides information about the current rate limit and your progress towards it via headers in the HTTP response. The following headers are available:
| Header Name | Description |
|---|---|
| RateLimit-Limit | The total number of requests allowed in the time window |
| RateLimit-Remaining | The number of requests you have remaining during the time window |
| RateLimit-Reset | Time (seconds since the Unix Epoch) when the time window resets |
Avoiding the rate limit in scripts
Here are several tips and techniques you can employ to stay under the rate limit.
- Delay/Sleep
- If you know you’re going to be performing many requests over a sustained period of time, one of the simplest methods is to introduce a slight delay between requests. That will allow you to remain under the rate limit indefinitely and your script to run uninterrupted.
- Caching
- Often we see many requests for the same entity repeated over and over. While CIViC data does update regularly, caching the result for a request for the duration of a script will help you stay under the rate limit and increase the performance of your script at the same time.
- Automated Backoff
- The most surefire way to make sure you never get rate limited is to use the HTTP response headers documented above. Before your script makes another request, it can check the
RateLimit-Remainingheader and if it sees a 1 or 0, not make additional requests untilRateLimit-Reset. You can also wait to get a429status code, put in a similar delay and retry your request.
- The most surefire way to make sure you never get rate limited is to use the HTTP response headers documented above. Before your script makes another request, it can check the
Reach out to us!
If you have a use case that isn’t being addressed, think you need an increased rate limit, or have questions about efficiently using the CIViC API, please send us an email at help@civicdb.org and we’d be happy to chat! Our goal is to keep the API freely accessible to everyone and not to limit usage as much as possible.